Incidental Mutation 'R4648:Lnx1'
ID 350475
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Name ligand of numb-protein X 1
Synonyms
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 74753108-74863573 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74771457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 350 (V350I)
Ref Sequence ENSEMBL: ENSMUSP00000113565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000117388] [ENSMUST00000117525] [ENSMUST00000121690] [ENSMUST00000153543] [ENSMUST00000127396]
AlphaFold O70263
Predicted Effect probably benign
Transcript: ENSMUST00000039744
AA Change: V360I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228
AA Change: V360I

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087161
AA Change: V460I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: V460I

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113531
AA Change: V301I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228
AA Change: V301I

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117388
AA Change: V460I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: V460I

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117525
AA Change: V360I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113837
Gene: ENSMUSG00000029228
AA Change: V360I

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121690
AA Change: V350I

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113565
Gene: ENSMUSG00000029228
AA Change: V350I

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
PDZ 178 253 5.33e-19 SMART
PDZ 285 358 2.27e-13 SMART
PDZ 407 484 8.27e-16 SMART
PDZ 537 614 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153543
AA Change: V301I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121094
Gene: ENSMUSG00000029228
AA Change: V301I

DomainStartEndE-ValueType
Blast:PDZ 2 105 9e-37 BLAST
Blast:PDZ 129 159 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140084
SMART Domains Protein: ENSMUSP00000117935
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
PDZ 1 47 2.73e-1 SMART
PDZ 79 154 1.51e-9 SMART
PDZ 156 233 8.27e-16 SMART
SCOP:d1qaua_ 274 322 3e-7 SMART
Blast:PDZ 286 322 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
2310079G19Rik T C 16: 88,424,255 (GRCm39) S79G probably benign Het
4930568D16Rik T A 2: 35,244,458 (GRCm39) Y298F probably damaging Het
Alpk2 A G 18: 65,482,953 (GRCm39) F352L probably damaging Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd33b T C 15: 31,325,170 (GRCm39) *129W probably null Het
Atp5pf T C 16: 84,625,343 (GRCm39) M87V probably benign Het
Atp8b3 A G 10: 80,361,457 (GRCm39) S822P possibly damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Bbs2 A T 8: 94,807,507 (GRCm39) V429E probably damaging Het
Bccip C T 7: 133,316,628 (GRCm39) L83F probably damaging Het
Brd9 G A 13: 74,088,895 (GRCm39) V198I probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Ccdc110 A T 8: 46,395,705 (GRCm39) Q532L possibly damaging Het
Cdh19 G A 1: 110,852,907 (GRCm39) L343F probably benign Het
Cep350 A G 1: 155,778,344 (GRCm39) S1653P possibly damaging Het
Cmtm4 A G 8: 105,082,952 (GRCm39) I135T possibly damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Crp A G 1: 172,525,704 (GRCm39) M1V probably null Het
Csmd1 G A 8: 16,048,788 (GRCm39) Q2305* probably null Het
Cyp2c38 T A 19: 39,449,132 (GRCm39) I74F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dcaf1 A T 9: 106,742,876 (GRCm39) probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dock7 C A 4: 98,857,881 (GRCm39) E1448* probably null Het
Dpf2 C T 19: 5,957,109 (GRCm39) R38H probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Etnk1 A G 6: 143,141,000 (GRCm39) Y248C probably damaging Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Gk2 T C 5: 97,603,579 (GRCm39) S420G probably benign Het
Gm26596 T C 10: 112,765,064 (GRCm39) probably benign Het
Gm5414 G T 15: 101,536,543 (GRCm39) N27K possibly damaging Het
Gskip A G 12: 105,664,988 (GRCm39) D9G probably benign Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
Hk1 T G 10: 62,140,558 (GRCm39) S105R probably benign Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Idnk A G 13: 58,310,683 (GRCm39) D67G probably benign Het
Igfbp5 G T 1: 72,903,222 (GRCm39) H118N probably benign Het
Irf4 A T 13: 30,947,580 (GRCm39) Y427F probably benign Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Kif7 T C 7: 79,358,939 (GRCm39) D512G probably damaging Het
Lamb3 T A 1: 193,013,665 (GRCm39) I513N probably damaging Het
Lipo3 A G 19: 33,760,860 (GRCm39) L174P probably damaging Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mast2 G T 4: 116,172,036 (GRCm39) Y637* probably null Het
Matn2 T C 15: 34,428,679 (GRCm39) I681T probably damaging Het
Med18 A T 4: 132,190,274 (GRCm39) V37D possibly damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mpg C A 11: 32,180,034 (GRCm39) C187* probably null Het
Mtmr14 A G 6: 113,237,567 (GRCm39) E256G probably benign Het
Myo7b C T 18: 32,100,178 (GRCm39) probably null Het
Nhsl3 G T 4: 129,115,733 (GRCm39) T977K probably benign Het
Nmt1 T A 11: 102,954,743 (GRCm39) V425D probably damaging Het
Nynrin T A 14: 56,110,351 (GRCm39) Y1819* probably null Het
Or10ak16 A G 4: 118,751,147 (GRCm39) N289S possibly damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Phc1 T C 6: 122,298,872 (GRCm39) I699V possibly damaging Het
Prkdc T G 16: 15,634,638 (GRCm39) D3594E probably benign Het
Pstpip1 A T 9: 56,032,502 (GRCm39) D246V probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Ror2 A T 13: 53,439,536 (GRCm39) C9* probably null Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Smarcad1 A G 6: 65,044,073 (GRCm39) E215G probably benign Het
Spag16 G A 1: 69,866,194 (GRCm39) R11Q probably null Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tbc1d5 A G 17: 51,043,251 (GRCm39) C746R probably benign Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trem1 G A 17: 48,551,590 (GRCm39) V84I probably benign Het
Tspan5 T C 3: 138,604,076 (GRCm39) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm39) R647G probably benign Het
Usp50 T A 2: 126,619,953 (GRCm39) I120F probably damaging Het
Vil1 T C 1: 74,471,457 (GRCm39) M746T probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Zfp750 T C 11: 121,402,706 (GRCm39) T681A probably benign Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74,846,378 (GRCm39) missense probably benign 0.00
IGL01538:Lnx1 APN 5 74,780,816 (GRCm39) missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74,788,027 (GRCm39) missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74,788,027 (GRCm39) missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74,846,420 (GRCm39) missense probably benign 0.02
IGL03188:Lnx1 APN 5 74,780,924 (GRCm39) missense probably damaging 1.00
bobcat UTSW 5 74,846,351 (GRCm39) missense probably damaging 1.00
Caracal UTSW 5 74,766,710 (GRCm39) missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74,781,008 (GRCm39) critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74,768,570 (GRCm39) splice site probably benign
R1343:Lnx1 UTSW 5 74,758,040 (GRCm39) missense probably damaging 0.98
R1533:Lnx1 UTSW 5 74,780,678 (GRCm39) missense probably damaging 1.00
R1681:Lnx1 UTSW 5 74,846,071 (GRCm39) missense probably benign
R1714:Lnx1 UTSW 5 74,768,398 (GRCm39) missense probably null 1.00
R1727:Lnx1 UTSW 5 74,768,577 (GRCm39) splice site probably null
R1806:Lnx1 UTSW 5 74,766,710 (GRCm39) missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74,780,727 (GRCm39) missense probably benign 0.25
R2879:Lnx1 UTSW 5 74,780,784 (GRCm39) missense probably benign 0.03
R2984:Lnx1 UTSW 5 74,846,083 (GRCm39) nonsense probably null
R3790:Lnx1 UTSW 5 74,789,027 (GRCm39) splice site probably benign
R3953:Lnx1 UTSW 5 74,766,750 (GRCm39) missense probably benign
R4509:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4510:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4511:Lnx1 UTSW 5 74,780,853 (GRCm39) missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74,846,204 (GRCm39) missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4624:Lnx1 UTSW 5 74,821,121 (GRCm39) intron probably benign
R4647:Lnx1 UTSW 5 74,771,457 (GRCm39) missense probably benign 0.16
R4877:Lnx1 UTSW 5 74,788,784 (GRCm39) missense probably benign 0.01
R4883:Lnx1 UTSW 5 74,768,530 (GRCm39) missense probably benign
R5256:Lnx1 UTSW 5 74,846,315 (GRCm39) missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74,838,230 (GRCm39) missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74,846,269 (GRCm39) nonsense probably null
R6408:Lnx1 UTSW 5 74,846,307 (GRCm39) missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74,768,541 (GRCm39) missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74,788,846 (GRCm39) missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74,788,846 (GRCm39) missense possibly damaging 0.94
R7261:Lnx1 UTSW 5 74,838,175 (GRCm39) nonsense probably null
R7511:Lnx1 UTSW 5 74,780,972 (GRCm39) missense probably benign 0.01
R7574:Lnx1 UTSW 5 74,846,099 (GRCm39) missense probably benign 0.33
R7670:Lnx1 UTSW 5 74,846,351 (GRCm39) missense probably damaging 1.00
R8145:Lnx1 UTSW 5 74,846,060 (GRCm39) missense probably benign 0.22
R9015:Lnx1 UTSW 5 74,780,783 (GRCm39) missense probably benign 0.00
R9224:Lnx1 UTSW 5 74,766,810 (GRCm39) missense probably benign 0.37
R9321:Lnx1 UTSW 5 74,780,991 (GRCm39) missense probably damaging 1.00
R9340:Lnx1 UTSW 5 74,758,584 (GRCm39) missense probably benign 0.01
R9704:Lnx1 UTSW 5 74,780,879 (GRCm39) missense probably benign 0.02
Z1177:Lnx1 UTSW 5 74,788,102 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCAAGAAGTAGCTCCTTGCAG -3'
(R):5'- AATATGTCCTTCCATCTTTGACCACAG -3'

Sequencing Primer
(F):5'- AGGAGCTGCTGACATGCCTG -3'
(R):5'- TCAGGGGGTGCTAACCTAG -3'
Posted On 2015-10-08