Incidental Mutation 'R3701:Cstf1'
ID258509
Institutional Source Beutler Lab
Gene Symbol Cstf1
Ensembl Gene ENSMUSG00000027498
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 1
Synonyms
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172370681-172382448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172380392 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 357 (T357A)
Ref Sequence ENSEMBL: ENSMUSP00000112076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116375] [ENSMUST00000151511]
Predicted Effect probably benign
Transcript: ENSMUST00000116375
AA Change: T357A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112076
Gene: ENSMUSG00000027498
AA Change: T357A

DomainStartEndE-ValueType
Pfam:CSTF1_dimer 6 62 5.4e-28 PFAM
WD40 97 136 2.61e-3 SMART
WD40 162 201 3.29e-9 SMART
WD40 206 245 6.88e0 SMART
WD40 248 290 9.02e-7 SMART
WD40 293 334 1.44e-5 SMART
Blast:WD40 337 382 8e-9 BLAST
WD40 385 425 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151511
SMART Domains Protein: ENSMUSP00000121178
Gene: ENSMUSG00000027498

DomainStartEndE-ValueType
PDB:2XZ2|A 8 59 2e-7 PDB
WD40 97 136 2.61e-3 SMART
Meta Mutation Damage Score 0.1931 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. Similar to mammalian G protein beta subunits, this protein contains transducin-like repeats. Several transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fam189a2 T C 19: 23,979,467 E354G probably benign Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Kcnj5 T C 9: 32,317,828 T25A possibly damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Nmur2 A G 11: 56,040,777 L36P probably damaging Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Pkd2l1 A G 19: 44,157,227 S186P probably damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc34 T C 4: 154,865,482 F964S probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Cstf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cstf1 APN 2 172373073 missense probably benign 0.32
IGL02306:Cstf1 APN 2 172372971 missense probably benign 0.02
IGL02553:Cstf1 APN 2 172377854 missense probably benign 0.19
IGL02756:Cstf1 APN 2 172375875 missense probably damaging 1.00
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0244:Cstf1 UTSW 2 172377710 missense possibly damaging 0.87
R1448:Cstf1 UTSW 2 172375875 missense probably damaging 1.00
R1770:Cstf1 UTSW 2 172373063 missense possibly damaging 0.59
R2055:Cstf1 UTSW 2 172380483 missense probably benign 0.00
R2146:Cstf1 UTSW 2 172375763 missense probably damaging 1.00
R3119:Cstf1 UTSW 2 172373070 missense possibly damaging 0.75
R4816:Cstf1 UTSW 2 172372985 missense probably damaging 1.00
R4893:Cstf1 UTSW 2 172380524 missense probably damaging 1.00
R4991:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R4992:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R5743:Cstf1 UTSW 2 172377833 missense probably damaging 1.00
R6386:Cstf1 UTSW 2 172377896 missense probably damaging 0.97
R7314:Cstf1 UTSW 2 172373034 missense probably damaging 1.00
R7843:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
R7926:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
X0026:Cstf1 UTSW 2 172375860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGCACTGTGGGTTTGAC -3'
(R):5'- ATCGCTGCACGTCATGAAG -3'

Sequencing Primer
(F):5'- TGTGTCACAGACCACCTGC -3'
(R):5'- CACGTCATGAAGCCAGGGTTG -3'
Posted On2015-01-23