Incidental Mutation 'R3717:Skint10'
ID259953
Institutional Source Beutler Lab
Gene Symbol Skint10
Ensembl Gene ENSMUSG00000048766
Gene Nameselection and upkeep of intraepithelial T cells 10
SynonymsA030001H23Rik
MMRRC Submission 040709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3717 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112711147-112774866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112746739 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 84 (W84R)
Ref Sequence ENSEMBL: ENSMUSP00000058838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060327]
Predicted Effect probably damaging
Transcript: ENSMUST00000060327
AA Change: W84R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058838
Gene: ENSMUSG00000048766
AA Change: W84R

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:4F8T|A 50 149 5e-8 PDB
Blast:IG_like 56 143 3e-11 BLAST
transmembrane domain 162 184 N/A INTRINSIC
transmembrane domain 212 229 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 C T 16: 45,731,774 W245* probably null Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bpifb6 A G 2: 153,908,141 probably benign Het
Cmtr2 T C 8: 110,221,754 V232A probably damaging Het
Cmya5 A T 13: 93,092,487 M2031K probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Fgfr2 G A 7: 130,182,757 T270M probably damaging Het
Hoxd10 C T 2: 74,694,130 T262I probably damaging Het
Htt G A 5: 34,811,522 probably benign Het
Kbtbd3 A T 9: 4,330,598 H324L probably benign Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nxpe5 T C 5: 138,251,624 S559P probably damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr826 T A 10: 130,180,500 I127F possibly damaging Het
Ptx3 G T 3: 66,224,955 S299I probably benign Het
Rbbp4 T A 4: 129,328,632 D89V probably benign Het
Rfx4 A G 10: 84,880,224 E375G probably damaging Het
Senp7 T A 16: 56,179,057 probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skiv2l2 A G 13: 112,895,595 F561S probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spata18 A T 5: 73,666,850 probably null Het
St8sia6 T C 2: 13,656,934 N362S possibly damaging Het
Tmub2 G T 11: 102,285,061 probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ttn T C 2: 76,944,710 D1996G possibly damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vdac1 A G 11: 52,376,646 probably null Het
Vps51 G A 19: 6,077,168 probably benign Het
Zfp90 A G 8: 106,424,050 R132G probably benign Het
Other mutations in Skint10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02660:Skint10 APN 4 112765030 unclassified probably benign
IGL02891:Skint10 APN 4 112728826 missense probably benign 0.03
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0540:Skint10 UTSW 4 112773027 critical splice donor site probably null
R0544:Skint10 UTSW 4 112728811 splice site probably benign
R0711:Skint10 UTSW 4 112715905 splice site probably benign
R1135:Skint10 UTSW 4 112711463 nonsense probably null
R1341:Skint10 UTSW 4 112765031 unclassified probably benign
R2845:Skint10 UTSW 4 112715826 missense probably benign 0.00
R3718:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R4349:Skint10 UTSW 4 112769771 makesense probably null
R4857:Skint10 UTSW 4 112746633 missense possibly damaging 0.92
R4988:Skint10 UTSW 4 112728872 nonsense probably null
R5010:Skint10 UTSW 4 112727672 missense probably benign 0.14
R5354:Skint10 UTSW 4 112711593 missense possibly damaging 0.57
R5567:Skint10 UTSW 4 112715870 missense probably damaging 0.98
R5716:Skint10 UTSW 4 112711647 missense probably damaging 0.97
R5827:Skint10 UTSW 4 112746775 missense probably benign 0.00
R6705:Skint10 UTSW 4 112773104 intron probably benign
R7220:Skint10 UTSW 4 112728973 missense probably benign 0.00
R7620:Skint10 UTSW 4 112715817 missense possibly damaging 0.78
R7724:Skint10 UTSW 4 112765092 nonsense probably null
R7827:Skint10 UTSW 4 112774806 nonsense probably null
R8007:Skint10 UTSW 4 112711668 missense possibly damaging 0.87
R8056:Skint10 UTSW 4 112715813 missense probably benign 0.02
X0028:Skint10 UTSW 4 112746665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGGTAGGACAACGCTTC -3'
(R):5'- GACTATCCACATTCCCAATGGG -3'

Sequencing Primer
(F):5'- CTCCCGATTAGTTGTTACATTG -3'
(R):5'- GACCACTGGGAATGACAACTTTC -3'
Posted On2015-01-23