Incidental Mutation 'ANU22:Zfp397'
ID262615
Institutional Source Beutler Lab
Gene Symbol Zfp397
Ensembl Gene ENSMUSG00000024276
Gene Namezinc finger protein 397
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #ANU22
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location23954692-23964673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23960751 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 431 (S431L)
Ref Sequence ENSEMBL: ENSMUSP00000057253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060762] [ENSMUST00000225682]
Predicted Effect probably damaging
Transcript: ENSMUST00000060762
AA Change: S431L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057253
Gene: ENSMUSG00000024276
AA Change: S431L

DomainStartEndE-ValueType
SCAN 46 158 4e-68 SMART
ZnF_C2H2 278 300 1.58e-3 SMART
ZnF_C2H2 306 328 7.37e-4 SMART
ZnF_C2H2 334 356 1.22e-4 SMART
ZnF_C2H2 362 384 9.58e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 1.6e-4 SMART
ZnF_C2H2 446 468 4.54e-4 SMART
ZnF_C2H2 474 496 3.49e-5 SMART
ZnF_C2H2 502 524 2.12e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224107
Predicted Effect probably benign
Transcript: ENSMUST00000225682
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 98.1%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a N-terminal SCAN domain, and the longer isoform contains nine C2H2-type zinc finger repeats in the C-terminal domain. The protein localizes to centromeres during interphase and early prophase, and different isoforms can repress or activate transcription in transfection studies. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 A G 15: 81,913,714 E663G possibly damaging Het
Adam29 T A 8: 55,871,844 H525L probably benign Het
Adamts2 A G 11: 50,737,363 N297D probably benign Het
Adamts6 T A 13: 104,390,082 V506E probably damaging Het
Ankfy1 G A 11: 72,764,791 E1101K probably damaging Het
Arap3 C T 18: 37,991,327 probably null Het
Asxl3 T A 18: 22,516,446 H497Q probably benign Het
Caln1 A G 5: 130,669,551 E96G probably damaging Het
Cdh23 T C 10: 60,312,624 T2653A probably damaging Het
Cdk5rap2 T A 4: 70,380,235 I87F possibly damaging Het
Crybg3 T A 16: 59,529,227 H934L probably damaging Het
Cyp2d22 G A 15: 82,371,668 T461I probably damaging Het
Dhcr24 T C 4: 106,572,278 F183L possibly damaging Het
Dusp16 A T 6: 134,718,861 S336T probably benign Het
F930017D23Rik T G 10: 43,604,375 noncoding transcript Het
Fasl A G 1: 161,781,838 V193A probably damaging Het
Fgf5 T C 5: 98,275,316 Y187H probably damaging Het
Focad C A 4: 88,393,547 Q1423K probably benign Het
Gabrp T C 11: 33,555,055 T249A probably damaging Het
Galnt5 A T 2: 58,025,342 K637* probably null Het
Grm6 A T 11: 50,859,519 D503V probably benign Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Lyst C T 13: 13,678,056 R2214C probably benign Het
Micu2 T A 14: 57,943,625 D184V probably damaging Het
Nabp2 T A 10: 128,408,762 I52F probably damaging Het
Nat8f7 A T 6: 85,707,588 L90* probably null Het
Olfr1297 T C 2: 111,621,201 N291S probably damaging Het
Olfr30 A T 11: 58,455,262 M229K probably damaging Het
Pphln1 A G 15: 93,489,104 E273G probably damaging Het
Ppil1 C A 17: 29,263,888 V14F possibly damaging Het
Ptprd C A 4: 76,100,456 D694Y probably damaging Het
Relt A T 7: 100,851,698 L28Q probably damaging Het
Sptbn4 G A 7: 27,357,387 R2525* probably null Het
St8sia5 G A 18: 77,254,662 G320D probably damaging Het
Taf2 T C 15: 55,048,274 E582G probably damaging Het
Tas2r116 T A 6: 132,855,443 N2K probably benign Het
Tedc1 C T 12: 113,163,188 R357* probably null Het
Tmem168 A T 6: 13,583,046 V612E probably damaging Het
Unc79 A G 12: 103,001,871 S119G probably damaging Het
Washc5 T A 15: 59,355,839 K425* probably null Het
Wdr61 C A 9: 54,728,186 V44L probably damaging Het
Wtap G T 17: 12,967,895 T255K probably benign Het
Zfp148 T C 16: 33,456,943 V134A probably benign Het
Other mutations in Zfp397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01903:Zfp397 APN 18 23960029 missense probably benign
R1986:Zfp397 UTSW 18 23960051 missense possibly damaging 0.72
R4676:Zfp397 UTSW 18 23960797 nonsense probably null
R4824:Zfp397 UTSW 18 23960192 missense probably benign 0.02
R5471:Zfp397 UTSW 18 23960024 missense probably benign 0.00
R5735:Zfp397 UTSW 18 23960192 missense possibly damaging 0.76
R7134:Zfp397 UTSW 18 23957065 missense probably benign
R7231:Zfp397 UTSW 18 23960358 missense probably damaging 1.00
R7753:Zfp397 UTSW 18 23957072 missense probably benign 0.00
R8135:Zfp397 UTSW 18 23956507 missense probably damaging 1.00
R8213:Zfp397 UTSW 18 23960722 missense probably damaging 1.00
R8251:Zfp397 UTSW 18 23960304 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCAGCAAAGAAGTTCCCCTGTCC -3'
(R):5'- CTGACCTGTGCCTAAAAGCCTTCC -3'

Sequencing Primer
(F):5'- acaacatttctctctaacacaacatc -3'
(R):5'- ttcattacatatatacgcttcatccc -3'
Posted On2015-02-04