Incidental Mutation 'R2966:Noa1'
ID264647
Institutional Source Beutler Lab
Gene Symbol Noa1
Ensembl Gene ENSMUSG00000036285
Gene Namenitric oxide associated 1
Synonyms2610024G14Rik, mAtNOS1
MMRRC Submission 040522-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2966 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location77294182-77310084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77306344 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 483 (E483G)
Ref Sequence ENSEMBL: ENSMUSP00000045948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000047860]
Predicted Effect probably benign
Transcript: ENSMUST00000031167
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047860
AA Change: E483G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045948
Gene: ENSMUSG00000036285
AA Change: E483G

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 83 125 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
Pfam:MMR_HSR1 342 526 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150722
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear-encoded GTPase that functions in the mitochondrion. Upon translation, this protein is imported into the nucleus and then into the nucleolus before being exported to the mitochondrion. The encoded protein is required for oxygen-dependent regulation of mitochondrial respiratory complexes and for mitochondrial protein synthesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis associated with developmental retardation, decreased cell proliferation and apoptosis, increased cell necrosis, and abnormal mitochondrial morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
9230110C19Rik C T 9: 8,027,174 R121Q probably damaging Het
Adamts1 A G 16: 85,796,774 V691A possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp11a A T 8: 12,847,853 probably null Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Bnc2 G A 4: 84,293,517 A300V probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gabra5 T C 7: 57,408,641 E453G probably damaging Het
Gatd1 T A 7: 141,409,167 D193V probably damaging Het
Gm6871 T G 7: 41,573,440 T75P probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Has2 A G 15: 56,682,137 L23P probably damaging Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Myh1 A G 11: 67,214,584 K1067E probably damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nsd2 G C 5: 33,846,122 E205D probably benign Het
Pclo T C 5: 14,681,150 L3222P unknown Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Rbm15b A G 9: 106,885,592 L459P probably damaging Het
Recql A G 6: 142,363,587 V586A probably benign Het
Rprd2 A T 3: 95,766,433 probably null Het
Sis T A 3: 72,889,010 I1813L probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sympk T C 7: 19,030,544 V58A probably damaging Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r39 A C 6: 66,804,731 I201S possibly damaging Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Noa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Noa1 APN 5 77307579 missense probably benign
IGL02850:Noa1 APN 5 77294491 missense probably benign 0.14
R0149:Noa1 UTSW 5 77297173 nonsense probably null
R0361:Noa1 UTSW 5 77297173 nonsense probably null
R0645:Noa1 UTSW 5 77309875 missense probably benign 0.00
R1226:Noa1 UTSW 5 77307555 missense possibly damaging 0.82
R1710:Noa1 UTSW 5 77309725 missense possibly damaging 0.49
R1721:Noa1 UTSW 5 77307581 missense probably benign 0.00
R1732:Noa1 UTSW 5 77306374 missense probably benign 0.01
R2061:Noa1 UTSW 5 77304187 missense possibly damaging 0.64
R2262:Noa1 UTSW 5 77309804 nonsense probably null
R2965:Noa1 UTSW 5 77306344 missense possibly damaging 0.79
R4405:Noa1 UTSW 5 77306372 missense probably benign 0.00
R4664:Noa1 UTSW 5 77299753 missense probably benign 0.31
R4849:Noa1 UTSW 5 77306332 missense possibly damaging 0.61
R4920:Noa1 UTSW 5 77306487 splice site probably null
R5005:Noa1 UTSW 5 77309026 missense probably damaging 1.00
R5325:Noa1 UTSW 5 77304195 missense probably damaging 1.00
R6112:Noa1 UTSW 5 77309746 missense probably benign 0.01
R6254:Noa1 UTSW 5 77309669 missense probably benign 0.12
R7659:Noa1 UTSW 5 77309390 missense not run
R7810:Noa1 UTSW 5 77309224 missense probably damaging 0.99
R7879:Noa1 UTSW 5 77297197 missense probably benign 0.01
R7911:Noa1 UTSW 5 77309830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACCGCATATACATTCATCCG -3'
(R):5'- GCATTAAAGGAGTGTCTGATAACC -3'

Sequencing Primer
(F):5'- CGCATATACATTCATCCGTGAACTG -3'
(R):5'- GGAGTGTCTGATAACCTCTGTTTAAC -3'
Posted On2015-02-05