Mutagenetix > Incidental Mutation

Incidental Mutation 'R2966:Rprd2'

264640

Institutional Source

Beutler Lab

Gene Symbol

Rprd2

Ensembl Gene

ENSMUSG00000028106

Gene Name

regulation of nuclear pre-mRNA domain containing 2

Synonyms

6720469I21Rik, 2810036A19Rik, 4930535B03Rik

MMRRC Submission

040522-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R2966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95760341-95818863 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 95766433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090791] [ENSMUST00000090791]

AlphaFold

Q6NXI6

Predicted Effect

probably null
Transcript: ENSMUST00000090791

SMART Domains

Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106

Domain	Start	End	E-Value	Type
RPR	26	146	3.6e-29	SMART
Pfam:CREPT	210	351	9.3e-11	PFAM
low complexity region	431	465	N/A	INTRINSIC
low complexity region	576	591	N/A	INTRINSIC
low complexity region	612	633	N/A	INTRINSIC
low complexity region	670	686	N/A	INTRINSIC
low complexity region	777	793	N/A	INTRINSIC
low complexity region	1159	1179	N/A	INTRINSIC
low complexity region	1195	1208	N/A	INTRINSIC
low complexity region	1230	1238	N/A	INTRINSIC
low complexity region	1272	1295	N/A	INTRINSIC
low complexity region	1300	1323	N/A	INTRINSIC
low complexity region	1373	1409	N/A	INTRINSIC
low complexity region	1446	1467	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090791

SMART Domains

Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106

Domain	Start	End	E-Value	Type
RPR	26	146	3.6e-29	SMART
Pfam:CREPT	210	351	9.3e-11	PFAM
low complexity region	431	465	N/A	INTRINSIC
low complexity region	576	591	N/A	INTRINSIC
low complexity region	612	633	N/A	INTRINSIC
low complexity region	670	686	N/A	INTRINSIC
low complexity region	777	793	N/A	INTRINSIC
low complexity region	1159	1179	N/A	INTRINSIC
low complexity region	1195	1208	N/A	INTRINSIC
low complexity region	1230	1238	N/A	INTRINSIC
low complexity region	1272	1295	N/A	INTRINSIC
low complexity region	1300	1323	N/A	INTRINSIC
low complexity region	1373	1409	N/A	INTRINSIC
low complexity region	1446	1467	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198740

Predicted Effect

probably null
Transcript: ENSMUST00000200164

Predicted Effect

probably null
Transcript: ENSMUST00000200164

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	C	T	7: 41,626,405	R511*	probably null	Het
9230110C19Rik	C	T	9: 8,027,174	R121Q	probably damaging	Het
Adamts1	A	G	16: 85,796,774	V691A	possibly damaging	Het
Add1	C	A	5: 34,630,714	D702E	probably benign	Het
Ap1s1	T	C	5: 137,037,503	D148G	probably damaging	Het
Asprv1	T	A	6: 86,628,366	C65S	probably damaging	Het
Atp11a	A	T	8: 12,847,853		probably null	Het
Atp8a1	T	C	5: 67,647,706	D1022G	probably benign	Het
Bahd1	C	T	2: 118,916,406	P169S	probably damaging	Het
Bnc2	G	A	4: 84,293,517	A300V	probably benign	Het
Cep250	A	G	2: 155,994,878	K2256E	probably benign	Het
Chrna2	T	C	14: 66,149,368	V321A	possibly damaging	Het
Chsy1	G	A	7: 66,172,164	G716R	probably damaging	Het
Col2a1	A	G	15: 97,976,095	I1402T	unknown	Het
Ddx43	C	A	9: 78,406,379	Y197*	probably null	Het
Dyrk2	T	A	10: 118,860,337	K339*	probably null	Het
Fbxw21	A	G	9: 109,145,510	I314T	probably benign	Het
Fgd6	T	A	10: 94,044,194	F303L	probably benign	Het
Fstl3	T	C	10: 79,781,223	V200A	probably benign	Het
Gabra5	T	C	7: 57,408,641	E453G	probably damaging	Het
Gatd1	T	A	7: 141,409,167	D193V	probably damaging	Het
Gm6871	T	G	7: 41,573,440	T75P	probably benign	Het
Gpr45	G	A	1: 43,032,508	D104N	possibly damaging	Het
Has2	A	G	15: 56,682,137	L23P	probably damaging	Het
Lrriq1	A	G	10: 103,214,900	S664P	probably benign	Het
Ltf	G	T	9: 111,028,472	C443F	possibly damaging	Het
Mgam	T	C	6: 40,768,220	V1807A	possibly damaging	Het
Myh1	A	G	11: 67,214,584	K1067E	probably damaging	Het
Nav2	C	T	7: 49,557,032	T1535I	probably damaging	Het
Noa1	T	C	5: 77,306,344	E483G	possibly damaging	Het
Nsd2	G	C	5: 33,846,122	E205D	probably benign	Het
Pclo	T	C	5: 14,681,150	L3222P	unknown	Het
Pnpla2	C	T	7: 141,458,478	L215F	probably damaging	Het
Prss35	A	G	9: 86,755,582	D135G	probably damaging	Het
Pth	T	C	7: 113,385,929	H79R	probably benign	Het
Rab21	T	C	10: 115,294,909	N164S	probably benign	Het
Rasal1	T	A	5: 120,671,620	L530Q	probably damaging	Het
Rbm15b	A	G	9: 106,885,592	L459P	probably damaging	Het
Recql	A	G	6: 142,363,587	V586A	probably benign	Het
Sis	T	A	3: 72,889,010	I1813L	probably benign	Het
Slc4a5	C	T	6: 83,296,669	T997I	probably damaging	Het
Sympk	T	C	7: 19,030,544	V58A	probably damaging	Het
Trav7d-4	C	T	14: 52,770,127	Q26*	probably null	Het
Usp48	G	A	4: 137,613,762	V358M	probably damaging	Het
Vmn1r39	A	C	6: 66,804,731	I201S	possibly damaging	Het
Zcchc8	A	G	5: 123,720,867	S22P	probably benign	Het

Other mutations in Rprd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Rprd2	APN	3	95765379	missense	possibly damaging	0.95
IGL00773:Rprd2	APN	3	95765109	missense	probably damaging	1.00
IGL00792:Rprd2	APN	3	95785104	missense	probably benign	0.05
IGL01022:Rprd2	APN	3	95763754	nonsense	probably null
IGL01121:Rprd2	APN	3	95776550	missense	probably damaging	1.00
IGL01299:Rprd2	APN	3	95776547	missense	probably damaging	1.00
IGL01387:Rprd2	APN	3	95765319	missense	probably benign
IGL01414:Rprd2	APN	3	95765525	missense	probably damaging	1.00
IGL02283:Rprd2	APN	3	95765503	missense	probably damaging	0.98
IGL02336:Rprd2	APN	3	95787310	missense	probably benign	0.17
R0131:Rprd2	UTSW	3	95774361	missense	probably damaging	1.00
R0131:Rprd2	UTSW	3	95774361	missense	probably damaging	1.00
R0132:Rprd2	UTSW	3	95774361	missense	probably damaging	1.00
R0574:Rprd2	UTSW	3	95774357	missense	possibly damaging	0.58
R0718:Rprd2	UTSW	3	95766387	missense	probably benign	0.30
R0847:Rprd2	UTSW	3	95765413	missense	probably benign	0.00
R0942:Rprd2	UTSW	3	95765418	missense	probably damaging	1.00
R0943:Rprd2	UTSW	3	95784247	missense	possibly damaging	0.88
R0980:Rprd2	UTSW	3	95765904	missense	probably damaging	1.00
R1448:Rprd2	UTSW	3	95818576	missense	possibly damaging	0.57
R1542:Rprd2	UTSW	3	95765676	missense	possibly damaging	0.69
R1577:Rprd2	UTSW	3	95764735	missense	probably damaging	1.00
R1598:Rprd2	UTSW	3	95818739	unclassified	probably benign
R1640:Rprd2	UTSW	3	95763747	unclassified	probably benign
R1670:Rprd2	UTSW	3	95764803	missense	probably damaging	1.00
R2430:Rprd2	UTSW	3	95764795	nonsense	probably null
R3612:Rprd2	UTSW	3	95764152	missense	probably damaging	0.98
R3712:Rprd2	UTSW	3	95764560	missense	probably damaging	0.97
R3890:Rprd2	UTSW	3	95765224	missense	probably damaging	1.00
R4777:Rprd2	UTSW	3	95787374	missense	probably benign	0.41
R4783:Rprd2	UTSW	3	95774333	missense	probably benign	0.03
R4832:Rprd2	UTSW	3	95774171	missense	probably damaging	1.00
R4928:Rprd2	UTSW	3	95764537	missense	probably damaging	1.00
R4976:Rprd2	UTSW	3	95766349	missense	probably damaging	1.00
R4989:Rprd2	UTSW	3	95765320	missense	probably benign	0.03
R5134:Rprd2	UTSW	3	95765320	missense	probably benign	0.03
R5244:Rprd2	UTSW	3	95790182	missense	possibly damaging	0.80
R5314:Rprd2	UTSW	3	95764089	missense	possibly damaging	0.53
R5579:Rprd2	UTSW	3	95785059	missense	probably damaging	1.00
R5954:Rprd2	UTSW	3	95764863	missense	probably damaging	1.00
R6016:Rprd2	UTSW	3	95787373	missense	probably damaging	0.97
R6332:Rprd2	UTSW	3	95780441	missense	probably damaging	0.99
R6403:Rprd2	UTSW	3	95766087	missense	possibly damaging	0.77
R6415:Rprd2	UTSW	3	95774219	missense	probably benign	0.00
R7064:Rprd2	UTSW	3	95765016	missense	probably damaging	1.00
R7313:Rprd2	UTSW	3	95776710	missense	probably damaging	1.00
R7496:Rprd2	UTSW	3	95765775	missense	probably damaging	1.00
R7535:Rprd2	UTSW	3	95776587	missense	probably damaging	0.96
R8716:Rprd2	UTSW	3	95776793	missense	probably damaging	1.00
R8822:Rprd2	UTSW	3	95784301	missense	probably damaging	1.00
R8891:Rprd2	UTSW	3	95764055	missense	possibly damaging	0.85
R8922:Rprd2	UTSW	3	95780584	missense	probably damaging	0.99
R9030:Rprd2	UTSW	3	95784310	missense	probably benign	0.15
R9623:Rprd2	UTSW	3	95772193	missense	probably benign	0.30
RF034:Rprd2	UTSW	3	95766320	small deletion	probably benign
RF056:Rprd2	UTSW	3	95766319	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTTGCTGAAGTGGAAGAG -3'
(R):5'- ACTATCTGAGTGCTTTGCTGTC -3'

Sequencing Primer
(F):5'- CTTGCTGAAGTGGAAGAGACTTC -3'
(R):5'- CTGAGTGCTTTGCTGTCTTAGATTG -3'

Posted On

2015-02-05