Incidental Mutation 'R3082:L2hgdh'
ID265497
Institutional Source Beutler Lab
Gene Symbol L2hgdh
Ensembl Gene ENSMUSG00000020988
Gene NameL-2-hydroxyglutarate dehydrogenase
Synonyms
MMRRC Submission 040572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R3082 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69690433-69724873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69722084 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 85 (D85N)
Ref Sequence ENSEMBL: ENSMUSP00000021370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021370] [ENSMUST00000021372] [ENSMUST00000220460] [ENSMUST00000220539] [ENSMUST00000220916] [ENSMUST00000222950]
Predicted Effect probably benign
Transcript: ENSMUST00000021370
AA Change: D85N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021370
Gene: ENSMUSG00000020988
AA Change: D85N

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:DAO 51 457 1.9e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021372
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000220460
Predicted Effect probably benign
Transcript: ENSMUST00000220539
Predicted Effect probably benign
Transcript: ENSMUST00000220916
Predicted Effect probably benign
Transcript: ENSMUST00000222950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222972
Predicted Effect probably benign
Transcript: ENSMUST00000223387
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes L-2-hydroxyglutarate dehydrogenase, a FAD-dependent enzyme that oxidizes L-2-hydroxyglutarate to alpha-ketoglutarate in a variety of mammalian tissues. Mutations in this gene cause L-2-hydroxyglutaric aciduria, a rare autosomal recessive neurometabolic disorder resulting in moderate to severe mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit increased levels of lysine and arginine associated with decreases in saccharopine, glutamine, and glutamate in adult brains, neurobehavioral deficits, and brain spongiosis with vacuolar lesions mostly affecting oligodendrocytes and myelin sheaths. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss3 A G 10: 107,023,715 V341A possibly damaging Het
Adam11 T C 11: 102,770,117 probably benign Het
Aox2 G T 1: 58,283,600 probably benign Het
Cdh6 T C 15: 13,044,752 D428G probably damaging Het
Cep63 T C 9: 102,602,497 T339A probably benign Het
Clcn1 T C 6: 42,290,178 Y66H probably damaging Het
Cpsf2 C G 12: 101,988,810 S280C probably damaging Het
Dcaf6 G T 1: 165,422,852 probably benign Het
Ddx39 T A 8: 83,722,706 N344K possibly damaging Het
Dvl1 T C 4: 155,847,859 V42A possibly damaging Het
Ep400 A G 5: 110,693,230 probably benign Het
Epb41l5 C T 1: 119,609,262 V300I probably damaging Het
Fbln1 T G 15: 85,265,253 I617S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grin3a G A 4: 49,665,243 R1131W probably benign Het
Incenp T A 19: 9,883,779 M480L unknown Het
Ints13 G T 6: 146,574,707 Q99K possibly damaging Het
Lct A G 1: 128,287,608 Y1744H probably damaging Het
Macf1 T C 4: 123,361,443 probably null Het
Mpdz A T 4: 81,285,458 probably benign Het
Naa15 T C 3: 51,460,050 L498P probably damaging Het
Naip6 T A 13: 100,316,417 E45D probably benign Het
Nedd4l T A 18: 65,178,978 N405K probably benign Het
Olfr1037 C T 2: 86,085,709 V23I probably benign Het
Olfr724 A G 14: 49,960,704 Y123H probably damaging Het
Pitpnc1 A G 11: 107,212,524 S250P possibly damaging Het
Ppp1r18 A G 17: 35,873,850 D131G probably damaging Het
Prdm5 A G 6: 65,936,085 D206G probably damaging Het
Pygl A G 12: 70,197,529 F455S probably damaging Het
Rictor A T 15: 6,774,857 Y565F probably benign Het
Ryr1 T C 7: 29,045,646 N3852D probably damaging Het
S1pr5 A T 9: 21,244,990 C47S probably damaging Het
Serpinf2 T C 11: 75,437,528 R65G probably benign Het
Slfn14 C T 11: 83,276,693 W665* probably null Het
Smu1 T C 4: 40,745,567 D251G probably damaging Het
Spata18 A G 5: 73,679,080 probably benign Het
Tex19.2 A G 11: 121,116,731 V297A probably benign Het
Tmem131l A G 3: 83,909,150 probably null Het
Trim9 T C 12: 70,255,113 R584G possibly damaging Het
Trpm7 A T 2: 126,844,422 N295K possibly damaging Het
Ugt2a3 A G 5: 87,325,675 V461A probably benign Het
Vmn1r45 A T 6: 89,933,742 M82K probably benign Het
Other mutations in L2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:L2hgdh APN 12 69701434 missense possibly damaging 0.67
IGL01505:L2hgdh APN 12 69721401 missense probably damaging 1.00
IGL01871:L2hgdh APN 12 69722095 missense probably damaging 1.00
IGL02169:L2hgdh APN 12 69721397 missense probably damaging 1.00
IGL02253:L2hgdh APN 12 69705760 splice site probably benign
IGL02670:L2hgdh APN 12 69692480 missense possibly damaging 0.86
IGL03069:L2hgdh APN 12 69692399 missense probably benign
R0054:L2hgdh UTSW 12 69721331 missense possibly damaging 0.82
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0579:L2hgdh UTSW 12 69701272 splice site probably benign
R1421:L2hgdh UTSW 12 69701318 missense probably benign
R1797:L2hgdh UTSW 12 69699566 missense probably benign
R7640:L2hgdh UTSW 12 69721357 nonsense probably null
Z1176:L2hgdh UTSW 12 69707132 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGACCCTCCTGTGGATTTC -3'
(R):5'- GTGAAGTTTGGTGAGGTCTATAAAC -3'

Sequencing Primer
(F):5'- ACCCCCTCCCTTCTTCCTAC -3'
(R):5'- ACTACAGATGGTTGTGAGTCACC -3'
Posted On2015-02-05