Incidental Mutation 'R3422:Otub1'
ID267099
Institutional Source Beutler Lab
Gene Symbol Otub1
Ensembl Gene ENSMUSG00000024767
Gene NameOTU domain, ubiquitin aldehyde binding 1
Synonyms
MMRRC Submission 040640-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3422 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7198202-7206316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7199059 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 237 (D237N)
Ref Sequence ENSEMBL: ENSMUSP00000115195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025679] [ENSMUST00000040261] [ENSMUST00000123594] [ENSMUST00000142085]
Predicted Effect probably damaging
Transcript: ENSMUST00000025679
AA Change: D267N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025679
Gene: ENSMUSG00000024767
AA Change: D267N

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Peptidase_C65 40 271 1e-89 PFAM
Pfam:OTU 86 266 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040261
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123594
AA Change: D237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115195
Gene: ENSMUSG00000024767
AA Change: D237N

DomainStartEndE-ValueType
Pfam:Peptidase_C65 10 241 2e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127241
Predicted Effect probably benign
Transcript: ENSMUST00000142085
SMART Domains Protein: ENSMUSP00000122945
Gene: ENSMUSG00000024767

DomainStartEndE-ValueType
Pfam:Peptidase_C65 10 95 2.6e-30 PFAM
Meta Mutation Damage Score 0.4613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Ahnak A G 19: 9,005,708 D1452G probably benign Het
Ahnak A G 19: 9,006,752 D1800G probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brca2 A G 5: 150,543,121 T2117A possibly damaging Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Ifit1bl1 T G 19: 34,593,950 N369T probably benign Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Me2 C T 18: 73,791,194 A316T probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmt2 A G 2: 3,284,388 E31G possibly damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Nwd2 G T 5: 63,725,193 V63L possibly damaging Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Soat2 T C 15: 102,156,809 probably benign Het
Spink5 A G 18: 44,010,244 K756R probably benign Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Vsig2 G A 9: 37,541,479 V195I possibly damaging Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp91 G A 19: 12,770,292 A489V probably benign Het
Other mutations in Otub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Otub1 APN 19 7204051 splice site probably benign
IGL02755:Otub1 APN 19 7206259 start codon destroyed probably benign 0.08
R1545:Otub1 UTSW 19 7199206 missense probably benign 0.31
R2261:Otub1 UTSW 19 7199496 splice site probably null
R4583:Otub1 UTSW 19 7204436 missense possibly damaging 0.55
R4822:Otub1 UTSW 19 7204429 missense probably damaging 1.00
R5267:Otub1 UTSW 19 7199992 missense probably damaging 1.00
R5929:Otub1 UTSW 19 7199985 missense probably damaging 1.00
R6144:Otub1 UTSW 19 7199153 nonsense probably null
R7849:Otub1 UTSW 19 7200060 missense probably damaging 0.99
R8098:Otub1 UTSW 19 7204429 missense probably damaging 1.00
R8443:Otub1 UTSW 19 7199995 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTTGGCAGGAATGCTTGG -3'
(R):5'- AACCCATGTGCAAGGAGAGC -3'

Sequencing Primer
(F):5'- GCATCCCCTTTAATAAAACATGGAAG -3'
(R):5'- TGCAAGGAGAGCGACCACATC -3'
Posted On2015-02-18