Incidental Mutation 'R3614:Pigp'
ID268381
Institutional Source Beutler Lab
Gene Symbol Pigp
Ensembl Gene ENSMUSG00000022940
Gene Namephosphatidylinositol glycan anchor biosynthesis, class P
SynonymsDcrc, Dscr5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R3614 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94358763-94371842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94364724 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000155972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113905] [ENSMUST00000113906] [ENSMUST00000113910] [ENSMUST00000113914] [ENSMUST00000113917] [ENSMUST00000138514] [ENSMUST00000232294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113905
AA Change: D113G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940
AA Change: D113G

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113906
AA Change: D113G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940
AA Change: D113G

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113910
AA Change: D142G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940
AA Change: D142G

DomainStartEndE-ValueType
Pfam:PIG-P 39 154 1.5e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113914
AA Change: D186G

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940
AA Change: D186G

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
Pfam:PIG-P 84 197 1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113917
SMART Domains Protein: ENSMUSP00000109550
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 43 135 5.6e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138514
AA Change: D146G

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114477
Gene: ENSMUSG00000022940
AA Change: D146G

DomainStartEndE-ValueType
Pfam:PIG-P 43 152 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146924
Predicted Effect possibly damaging
Transcript: ENSMUST00000232294
AA Change: D113G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,575,727 Y1598C probably benign Het
Asic4 A G 1: 75,473,058 D444G probably damaging Het
Cd3g A G 9: 44,980,289 F11S probably benign Het
Dsp A G 13: 38,177,199 T365A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Golga3 C A 5: 110,220,908 Q1365K probably damaging Het
Lama3 T A 18: 12,448,288 H601Q probably benign Het
Lmbrd2 A G 15: 9,177,711 D499G probably damaging Het
Olfr171 A G 16: 19,624,765 C112R probably damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Prex1 G A 2: 166,609,781 R256C probably damaging Het
Stxbp2 T A 8: 3,631,196 V10E possibly damaging Het
Vmn1r67 T C 7: 10,447,429 Y207H probably damaging Het
Other mutations in Pigp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Pigp APN 16 94364767 nonsense probably null
IGL02728:Pigp APN 16 94367607 missense probably damaging 1.00
schweinchen UTSW 16 94365441 missense probably damaging 1.00
R0092:Pigp UTSW 16 94365462 missense probably damaging 0.96
R4872:Pigp UTSW 16 94365450 missense probably benign 0.18
R4959:Pigp UTSW 16 94359147 missense probably benign 0.00
R4973:Pigp UTSW 16 94359147 missense probably benign 0.00
R5970:Pigp UTSW 16 94370194 critical splice acceptor site probably null
R6135:Pigp UTSW 16 94370206 missense probably benign 0.20
R6179:Pigp UTSW 16 94370367 missense probably null 0.99
R6732:Pigp UTSW 16 94365441 missense probably damaging 1.00
R7576:Pigp UTSW 16 94370405 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ATCTAAGGAATCAACTGTCATGTTTT -3'
(R):5'- CGTTGGGAGAAAGTCATCTGATA -3'

Sequencing Primer
(F):5'- GGAATCAACTGTCATGTTTTTACATG -3'
(R):5'- GGTGAACTGTCTCCGTACAACTAAG -3'
Posted On2015-02-19