Incidental Mutation 'R3736:4930432E11Rik'
ID270124
Institutional Source Beutler Lab
Gene Symbol 4930432E11Rik
Ensembl Gene ENSMUSG00000046958
Gene NameRIKEN cDNA 4930432E11 gene
Synonyms
MMRRC Submission 040723-MU
Accession Numbers

NCBI RefSeq: none; Ensembl: ENSMUST00000053635; MGI:3045259

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3736 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29558579-29582169 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 29574571 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053635
SMART Domains Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

DomainStartEndE-ValueType
Blast:WD40 43 79 3e-11 BLAST
WD40 131 172 1.97e2 SMART
WD40 175 214 2.24e-2 SMART
Blast:WD40 257 296 4e-15 BLAST
WD40 393 437 1.32e2 SMART
WD40 494 533 2.15e-4 SMART
low complexity region 598 617 N/A INTRINSIC
low complexity region 1082 1094 N/A INTRINSIC
low complexity region 1107 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063585
SMART Domains Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
internal_repeat_1 35 67 3.29e-5 PROSPERO
internal_repeat_1 73 102 3.29e-5 PROSPERO
low complexity region 122 135 N/A INTRINSIC
coiled coil region 161 182 N/A INTRINSIC
low complexity region 216 233 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187265
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
Acot12 T A 13: 91,784,346 I487N probably benign Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adgrf2 T C 17: 42,711,012 E307G probably benign Het
Ang2 G A 14: 51,195,656 R90* probably null Het
Ankrd11 A T 8: 122,891,785 V1776D probably damaging Het
Atp12a G A 14: 56,374,427 V353I possibly damaging Het
Bbs7 A G 3: 36,607,670 Y127H possibly damaging Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Ccdc162 T C 10: 41,589,568 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Clcn3 T A 8: 60,983,652 probably benign Het
Ctps T C 4: 120,543,746 T459A probably benign Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Evi5 A T 5: 107,818,983 V224D probably damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Kcnk10 A G 12: 98,489,912 V203A probably benign Het
Lef1 C T 3: 131,191,066 P160S possibly damaging Het
Lrmp G A 6: 145,160,870 probably benign Het
Lyn G T 4: 3,745,330 W78C probably damaging Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Morc3 T A 16: 93,874,812 V910E probably damaging Het
Mrvi1 A G 7: 110,923,963 V297A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nup210l A G 3: 90,120,013 Y234C probably damaging Het
Olfr502 A G 7: 108,523,419 V177A possibly damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Pde4dip A T 3: 97,724,111 F1161I probably damaging Het
Poc5 A G 13: 96,396,816 S151G probably damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Shtn1 A T 19: 59,022,268 S256T probably benign Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tas2r134 C A 2: 51,627,774 N88K probably damaging Het
Tbc1d32 A G 10: 56,129,093 Y815H probably damaging Het
Tnrc6b G C 15: 80,889,163 probably benign Het
Vti1a T A 19: 55,380,932 probably null Het
Zfp273 T A 13: 67,825,507 C251* probably null Het
Zfp683 C A 4: 134,057,431 Q330K probably benign Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Zscan4d T C 7: 11,162,876 N189S probably benign Het
Other mutations in 4930432E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:4930432E11Rik APN 7 29574001 unclassified noncoding transcript
IGL01955:4930432E11Rik APN 7 29573995 unclassified noncoding transcript
IGL01971:4930432E11Rik APN 7 29574562 unclassified noncoding transcript
IGL02132:4930432E11Rik APN 7 29563279 unclassified noncoding transcript
IGL02484:4930432E11Rik APN 7 29563352 unclassified noncoding transcript
P0016:4930432E11Rik UTSW 7 29563112 unclassified noncoding transcript
R0051:4930432E11Rik UTSW 7 29579101 exon noncoding transcript
R0060:4930432E11Rik UTSW 7 29574170 unclassified noncoding transcript
R0094:4930432E11Rik UTSW 7 29560811 exon noncoding transcript
R0268:4930432E11Rik UTSW 7 29574602 unclassified noncoding transcript
R0423:4930432E11Rik UTSW 7 29562400 exon noncoding transcript
R0478:4930432E11Rik UTSW 7 29562589 exon noncoding transcript
R0646:4930432E11Rik UTSW 7 29561285 exon noncoding transcript
R1208:4930432E11Rik UTSW 7 29561283 exon noncoding transcript
R1778:4930432E11Rik UTSW 7 29560706 exon noncoding transcript
R1779:4930432E11Rik UTSW 7 29579166 exon noncoding transcript
R1918:4930432E11Rik UTSW 7 29574089 unclassified noncoding transcript
R2360:4930432E11Rik UTSW 7 29574789 unclassified noncoding transcript
R3780:4930432E11Rik UTSW 7 29560838 exon noncoding transcript
R4427:4930432E11Rik UTSW 7 29579253 exon noncoding transcript
R4835:4930432E11Rik UTSW 7 29574901 unclassified noncoding transcript
R4929:4930432E11Rik UTSW 7 29574042 unclassified noncoding transcript
R5042:4930432E11Rik UTSW 7 29574502 unclassified noncoding transcript
R5129:4930432E11Rik UTSW 7 29561361 exon noncoding transcript
R5371:4930432E11Rik UTSW 7 29562493 exon noncoding transcript
R5381:4930432E11Rik UTSW 7 29562968 unclassified noncoding transcript
R5586:4930432E11Rik UTSW 7 29577728 unclassified noncoding transcript
R5874:4930432E11Rik UTSW 7 29581185 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AACGCATCAGTCCTCTCTGC -3'
(R):5'- AAGATCTCTTCAGCTCCCAGGG -3'

Sequencing Primer
(F):5'- TCTGCCTTAGTAGCTCTACTTAAAG -3'
(R):5'- AGCTCCCAGGGCCTCTTTG -3'
Posted On2015-03-18