Incidental Mutation 'R3736:Acot12'
ID270137
Institutional Source Beutler Lab
Gene Symbol Acot12
Ensembl Gene ENSMUSG00000021620
Gene Nameacyl-CoA thioesterase 12
SynonymsCach, 1300004O04Rik, 4930449F15Rik
MMRRC Submission 040723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3736 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91741512-91786148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91784346 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 487 (I487N)
Ref Sequence ENSEMBL: ENSMUSP00000022120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022120]
Predicted Effect probably benign
Transcript: ENSMUST00000022120
AA Change: I487N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022120
Gene: ENSMUSG00000021620
AA Change: I487N

DomainStartEndE-ValueType
Pfam:4HBT 25 97 4.2e-12 PFAM
Pfam:4HBT 198 275 2.5e-14 PFAM
low complexity region 317 328 N/A INTRINSIC
Pfam:START 350 515 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159214
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A T 5: 30,482,098 Y123F probably benign Het
4930432E11Rik G A 7: 29,574,571 noncoding transcript Het
Acox3 A G 5: 35,611,153 K686R probably benign Het
Adgrf2 T C 17: 42,711,012 E307G probably benign Het
Ang2 G A 14: 51,195,656 R90* probably null Het
Ankrd11 A T 8: 122,891,785 V1776D probably damaging Het
Atp12a G A 14: 56,374,427 V353I possibly damaging Het
Bbs7 A G 3: 36,607,670 Y127H possibly damaging Het
C8a T C 4: 104,817,615 E509G probably benign Het
Ccdc158 A C 5: 92,632,424 L930R possibly damaging Het
Ccdc162 T C 10: 41,589,568 probably null Het
Cep170b A T 12: 112,741,004 I395F probably damaging Het
Clcn3 T A 8: 60,983,652 probably benign Het
Ctps T C 4: 120,543,746 T459A probably benign Het
Cyp2j8 T A 4: 96,444,599 R503S probably damaging Het
Dync1h1 G A 12: 110,631,675 V1767I probably benign Het
Evi5 A T 5: 107,818,983 V224D probably damaging Het
F8 G A X: 75,211,375 P2138S probably damaging Het
Helq T G 5: 100,790,188 D464A possibly damaging Het
Kcnk10 A G 12: 98,489,912 V203A probably benign Het
Lef1 C T 3: 131,191,066 P160S possibly damaging Het
Lrmp G A 6: 145,160,870 probably benign Het
Lyn G T 4: 3,745,330 W78C probably damaging Het
Med12l T A 3: 59,091,495 H614Q probably damaging Het
Mogs C A 6: 83,116,776 T242K possibly damaging Het
Morc3 T A 16: 93,874,812 V910E probably damaging Het
Mrvi1 A G 7: 110,923,963 V297A probably benign Het
Ncapg A T 5: 45,696,127 Q906L probably benign Het
Nup210l A G 3: 90,120,013 Y234C probably damaging Het
Olfr502 A G 7: 108,523,419 V177A possibly damaging Het
Olr1 T A 6: 129,499,875 probably benign Het
Osmr A T 15: 6,822,080 Y656N probably damaging Het
Pde4dip A T 3: 97,724,111 F1161I probably damaging Het
Poc5 A G 13: 96,396,816 S151G probably damaging Het
Rmnd5a T C 6: 71,396,862 D316G possibly damaging Het
Shroom3 T C 5: 92,964,444 V1888A possibly damaging Het
Shtn1 A T 19: 59,022,268 S256T probably benign Het
Sptlc2 G A 12: 87,341,565 A381V probably benign Het
Suclg2 T A 6: 95,497,696 I363F probably damaging Het
Tas2r134 C A 2: 51,627,774 N88K probably damaging Het
Tbc1d32 A G 10: 56,129,093 Y815H probably damaging Het
Tnrc6b G C 15: 80,889,163 probably benign Het
Vti1a T A 19: 55,380,932 probably null Het
Zfp273 T A 13: 67,825,507 C251* probably null Het
Zfp683 C A 4: 134,057,431 Q330K probably benign Het
Zfpm1 G A 8: 122,323,736 C117Y possibly damaging Het
Zscan4d T C 7: 11,162,876 N189S probably benign Het
Other mutations in Acot12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Acot12 APN 13 91781211 nonsense probably null
IGL01114:Acot12 APN 13 91757592 splice site probably benign
IGL01376:Acot12 APN 13 91784671 missense probably damaging 0.98
IGL01474:Acot12 APN 13 91772783 missense possibly damaging 0.53
IGL02206:Acot12 APN 13 91759987 missense probably damaging 1.00
IGL02999:Acot12 APN 13 91759981 missense probably damaging 0.97
IGL03237:Acot12 APN 13 91781269 missense probably benign 0.26
R0071:Acot12 UTSW 13 91781174 splice site probably benign
R0092:Acot12 UTSW 13 91741565 missense probably damaging 1.00
R0141:Acot12 UTSW 13 91771828 missense probably benign 0.02
R0331:Acot12 UTSW 13 91760064 critical splice donor site probably null
R0525:Acot12 UTSW 13 91760067 splice site probably benign
R0544:Acot12 UTSW 13 91784656 missense probably benign 0.02
R1509:Acot12 UTSW 13 91771875 critical splice donor site probably null
R1616:Acot12 UTSW 13 91772767 missense probably benign 0.02
R1773:Acot12 UTSW 13 91757557 missense probably benign 0.27
R1897:Acot12 UTSW 13 91784397 missense probably benign
R2047:Acot12 UTSW 13 91783003 missense probably damaging 1.00
R2102:Acot12 UTSW 13 91759977 missense probably benign 0.00
R3730:Acot12 UTSW 13 91760026 missense possibly damaging 0.61
R3735:Acot12 UTSW 13 91784346 missense probably benign
R3912:Acot12 UTSW 13 91770089 missense probably benign 0.01
R4156:Acot12 UTSW 13 91784763 missense probably benign 0.00
R4418:Acot12 UTSW 13 91784405 missense possibly damaging 0.46
R4879:Acot12 UTSW 13 91762964 missense probably benign 0.17
R5456:Acot12 UTSW 13 91741640 missense probably damaging 1.00
R5498:Acot12 UTSW 13 91781233 missense probably damaging 1.00
R5601:Acot12 UTSW 13 91782910 missense probably benign 0.10
R5998:Acot12 UTSW 13 91757534 missense possibly damaging 0.49
R6781:Acot12 UTSW 13 91784412 splice site probably null
R7208:Acot12 UTSW 13 91781242 missense probably benign 0.06
R7330:Acot12 UTSW 13 91741532 start codon destroyed probably null 0.89
R7560:Acot12 UTSW 13 91784391 missense probably benign
R7561:Acot12 UTSW 13 91770124 missense probably damaging 0.96
R7869:Acot12 UTSW 13 91771725 missense probably benign 0.12
X0050:Acot12 UTSW 13 91771837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTTACTCCTGCAGAGAC -3'
(R):5'- CTGAAAATGTTGGTGAGTGAATCTG -3'

Sequencing Primer
(F):5'- CTGGATAACTTGCCTAGCATGCAG -3'
(R):5'- TCTGGAAGGAGTTAAGAGGAGTCC -3'
Posted On2015-03-18