Incidental Mutation 'R3763:Commd1'
ID270602
Institutional Source Beutler Lab
Gene Symbol Commd1
Ensembl Gene ENSMUSG00000051355
Gene NameCOMM domain containing 1
SynonymsMurr1
MMRRC Submission 040873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3763 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location22896136-22982382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22974102 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 292 (F292Y)
Ref Sequence ENSEMBL: ENSMUSP00000062025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049506] [ENSMUST00000057843] [ENSMUST00000071068] [ENSMUST00000159081] [ENSMUST00000160826]
Predicted Effect probably benign
Transcript: ENSMUST00000049506
AA Change: F292Y

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062025
Gene: ENSMUSG00000044068
AA Change: F292Y

DomainStartEndE-ValueType
low complexity region 14 39 N/A INTRINSIC
coiled coil region 52 144 N/A INTRINSIC
ZnF_C3H1 158 184 1.69e-3 SMART
RRM 190 291 1.44e-2 SMART
ZnF_C3H1 297 323 1.2e-3 SMART
low complexity region 364 389 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000057843
AA Change: E47V
SMART Domains Protein: ENSMUSP00000053606
Gene: ENSMUSG00000051355
AA Change: E47V

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:HCaRG 44 238 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071068
SMART Domains Protein: ENSMUSP00000065079
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:HCaRG 57 89 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093270
SMART Domains Protein: ENSMUSP00000090958
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
Pfam:HCaRG 3 137 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159081
SMART Domains Protein: ENSMUSP00000124719
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
Pfam:HCaRG 12 184 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160826
SMART Domains Protein: ENSMUSP00000125609
Gene: ENSMUSG00000098650

DomainStartEndE-ValueType
Pfam:HCaRG 1 99 1.3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230879
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COMMD1 is a regulator of copper homeostasis, sodium uptake, and NF-kappa-B (see MIM 164011) signaling (de Bie et al., 2005 [PubMed 16267171]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal with growth retardation, failure to turn, increased apoptosis in brain mesenchyme and defects in extraembryonic tissue development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,319 E29G possibly damaging Het
Aff3 A G 1: 38,252,689 probably benign Het
AW146154 A G 7: 41,480,370 C441R probably damaging Het
Cacna1a T C 8: 84,583,642 V1443A possibly damaging Het
Ddx18 A G 1: 121,561,377 Y314H probably damaging Het
Dna2 C T 10: 62,966,797 T898I probably damaging Het
Epc1 C A 18: 6,440,091 V59L possibly damaging Het
Etv6 C A 6: 134,263,012 probably benign Het
Fam118a A G 15: 85,053,797 D293G possibly damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gzmn A C 14: 56,166,904 S159A probably benign Het
Insc A G 7: 114,790,972 D26G probably damaging Het
L1td1 A G 4: 98,737,835 R756G probably damaging Het
Ltk A G 2: 119,751,837 L499P probably benign Het
Mast4 A T 13: 102,787,419 L291M probably damaging Het
Nefm G T 14: 68,124,348 R156S probably damaging Het
Nppc T A 1: 86,669,858 N63Y probably damaging Het
Olfr507 A T 7: 108,622,717 I302F probably damaging Het
Olfr816 A G 10: 129,911,445 S278P probably damaging Het
Pcdhb7 T C 18: 37,341,883 V24A probably benign Het
Pcm1 C A 8: 41,280,077 Q787K probably damaging Het
Prg3 A G 2: 84,992,990 K170E possibly damaging Het
Slc25a54 T C 3: 109,112,054 S325P probably damaging Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Spock3 T A 8: 63,144,015 probably null Het
Stk-ps2 G A 1: 46,029,921 noncoding transcript Het
Svep1 T G 4: 58,084,833 D1835A possibly damaging Het
Tmcc3 A G 10: 94,579,317 T294A probably benign Het
Tsen54 A G 11: 115,820,411 N62S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn2r18 G A 5: 151,585,179 A160V probably damaging Het
Wnk4 T C 11: 101,269,288 V661A probably benign Het
Zfhx4 A G 3: 5,403,344 Y2854C probably damaging Het
Zfp563 G T 17: 33,104,928 E166* probably null Het
Zfp687 T A 3: 95,012,080 N127I probably damaging Het
Zfp958 T A 8: 4,626,226 probably null Het
Other mutations in Commd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01601:Commd1 APN 11 22899981 missense probably damaging 1.00
IGL02275:Commd1 APN 11 22900017 missense probably damaging 1.00
R3702:Commd1 UTSW 11 22974057 missense probably damaging 1.00
R7853:Commd1 UTSW 11 22956532 missense possibly damaging 0.61
R8353:Commd1 UTSW 11 22978503 intron probably benign
R8370:Commd1 UTSW 11 22982104 missense probably damaging 1.00
R8453:Commd1 UTSW 11 22978503 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTCTACCATGACGTGCTGCC -3'
(R):5'- CCAGAGTGGTAGCTTCTTGAC -3'

Sequencing Primer
(F):5'- TGCTGCCGGAGTTCAAGAAC -3'
(R):5'- CTGAGTTTTTACCAGAGGAGCCAG -3'
Posted On2015-03-18