Incidental Mutation 'R3727:Caly'
ID270835
Institutional Source Beutler Lab
Gene Symbol Caly
Ensembl Gene ENSMUSG00000025468
Gene Namecalcyon neuron-specific vesicular protein
Synonyms0710001P07Rik, Calcyon, 1110004A22Rik, Drd1ip
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140069880-140082548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140070504 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 175 (E175G)
Ref Sequence ENSEMBL: ENSMUSP00000148173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026541] [ENSMUST00000166758] [ENSMUST00000211044] [ENSMUST00000211283]
Predicted Effect probably damaging
Transcript: ENSMUST00000026541
AA Change: E175G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026541
Gene: ENSMUSG00000025468
AA Change: E175G

DomainStartEndE-ValueType
Pfam:Calcyon 1 218 1.2e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166758
AA Change: E175G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130779
Gene: ENSMUSG00000025468
AA Change: E175G

DomainStartEndE-ValueType
Pfam:Calcyon 1 182 2.7e-80 PFAM
low complexity region 183 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211044
AA Change: E175G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000211283
AA Change: E175G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.3879 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II single transmembrane protein. It is required for maximal stimulated calcium release after stimulation of purinergic or muscarinic but not beta-adrenergic receptors. The encoded protein interacts with D1 dopamine receptor and may interact with other DA receptor subtypes and/or GPCRs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Neurons in homozygous null mice have defects in clathrin-mediated endocytosis (CME) that manifests as an absence of long term depression in post-synaptic currents of the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Caly
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4415:Caly UTSW 7 140072680 missense probably damaging 1.00
R4995:Caly UTSW 7 140070625 missense probably benign 0.01
R5766:Caly UTSW 7 140070397 missense probably benign 0.00
R6866:Caly UTSW 7 140070619 missense probably benign 0.16
R7861:Caly UTSW 7 140081388 intron probably benign
R7991:Caly UTSW 7 140071600 missense possibly damaging 0.95
R8735:Caly UTSW 7 140072590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGGCCGAGCACACTTAC -3'
(R):5'- CTGGTCCGGAATATGCATCC -3'

Sequencing Primer
(F):5'- ACTTACCCCAGTCACGGGC -3'
(R):5'- CGCTGCAGCACAAGATCTG -3'
Posted On2015-03-18