Incidental Mutation 'R3727:Mpi'
ID270837
Institutional Source Beutler Lab
Gene Symbol Mpi
Ensembl Gene ENSMUSG00000032306
Gene Namemannose phosphate isomerase
Synonyms1110002E17Rik, Mpi-1, Mpi1
MMRRC Submission 040718-MU
Accession Numbers

Genbank: NM_025837; MGI: 97075

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57544256-57552763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57544849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 381 (I381M)
Ref Sequence ENSEMBL: ENSMUSP00000034856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034856] [ENSMUST00000093833] [ENSMUST00000114200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034856
AA Change: I381M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034856
Gene: ENSMUSG00000032306
AA Change: I381M

DomainStartEndE-ValueType
Pfam:PMI_typeI 6 384 4.3e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093833
SMART Domains Protein: ENSMUSP00000091353
Gene: ENSMUSG00000032305

DomainStartEndE-ValueType
Pfam:FAM219A 72 128 4.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114200
SMART Domains Protein: ENSMUSP00000109838
Gene: ENSMUSG00000032305

DomainStartEndE-ValueType
Pfam:FAM219A 72 197 1.6e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145543
Predicted Effect probably benign
Transcript: ENSMUST00000156428
SMART Domains Protein: ENSMUSP00000119342
Gene: ENSMUSG00000032306

DomainStartEndE-ValueType
Pfam:PMI_typeI 3 119 3.1e-45 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, variable abnormalities of the yolk sac and embryonic vasculature, and partial penetrance of abnormal chorioallantoic fusion, placental defects, impaired emrbyo turning, increased apoptosis, and posterior axial truncations. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Kif13b A G 14: 64,765,748 probably benign Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Mpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Mpi APN 9 57552266 missense probably damaging 1.00
IGL01071:Mpi APN 9 57550592 missense probably damaging 1.00
IGL01604:Mpi APN 9 57550742 missense possibly damaging 0.85
IGL02090:Mpi APN 9 57550653 missense probably benign 0.00
benadryl UTSW 9 57550757 missense probably damaging 1.00
sleepies UTSW 9 57545189 unclassified probably benign
Zyrtec UTSW 9 57545217 missense probably damaging 1.00
F6893:Mpi UTSW 9 57546549 missense probably benign 0.12
R0751:Mpi UTSW 9 57550614 missense probably damaging 1.00
R1146:Mpi UTSW 9 57545189 unclassified probably benign
R3944:Mpi UTSW 9 57545253 missense probably damaging 1.00
R4645:Mpi UTSW 9 57550757 missense probably damaging 1.00
R4772:Mpi UTSW 9 57544898 missense probably damaging 1.00
R4856:Mpi UTSW 9 57545307 missense probably damaging 1.00
R5088:Mpi UTSW 9 57550604 missense probably damaging 0.97
R5504:Mpi UTSW 9 57545217 missense probably damaging 1.00
R5886:Mpi UTSW 9 57548462 unclassified probably benign
R7038:Mpi UTSW 9 57545217 missense probably damaging 1.00
R8043:Mpi UTSW 9 57550598 missense probably damaging 1.00
RF013:Mpi UTSW 9 57548641 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GATTGGGCTACACCTGAAATATGG -3'
(R):5'- CTTCGTAGTGCCAAGAGCTTG -3'

Sequencing Primer
(F):5'- CTACACCTGAAATATGGAGCTGGC -3'
(R):5'- TCGTAGTGCCAAGAGCTTGAATAATG -3'
Posted On2015-03-18