Incidental Mutation 'R3727:Kif13b'
ID270845
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission 040718-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3727 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 64765748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably benign
Transcript: ENSMUST00000100473
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224503
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 C T 15: 73,113,857 V630M probably damaging Het
Alk T C 17: 71,901,400 probably benign Het
Atp6v0a1 T A 11: 101,030,420 S243T probably benign Het
BC035044 C A 6: 128,890,859 G37* probably null Het
C3 G T 17: 57,207,379 N1435K possibly damaging Het
Caly T C 7: 140,070,504 E175G probably damaging Het
Ccng2 T C 5: 93,274,951 F330S probably damaging Het
Cyp2c38 A G 19: 39,392,295 probably benign Het
Cypt1 T A X: 16,523,435 L128* probably null Het
Dmgdh A G 13: 93,692,067 N239D probably damaging Het
Dnah8 C T 17: 30,739,648 Q2155* probably null Het
Dpp3 A G 19: 4,923,185 I127T probably benign Het
Dusp27 G A 1: 166,099,506 R846C probably damaging Het
Eps15 G T 4: 109,370,685 probably benign Het
Exosc10 A G 4: 148,565,277 D388G probably damaging Het
Flt3 C A 5: 147,354,923 R572S probably damaging Het
Gm44501 T C 17: 40,576,615 F8S unknown Het
Hormad2 C A 11: 4,408,598 G270C probably benign Het
Ifrd2 C T 9: 107,591,682 R40* probably null Het
Ina G A 19: 47,015,719 R322H possibly damaging Het
Lrp2 T C 2: 69,510,429 N1034S probably damaging Het
Macf1 T A 4: 123,459,311 E1770V probably damaging Het
Mpi T C 9: 57,544,849 I381M possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nt5c C T 11: 115,490,648 W185* probably null Het
Olfr137 A T 17: 38,305,419 I14N possibly damaging Het
Olfr1391 G A 11: 49,327,795 R128H probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pdzrn3 T A 6: 101,156,945 D441V probably damaging Het
Rab42 A G 4: 132,302,653 M86T probably benign Het
Slc52a3 C T 2: 152,005,781 P270S probably benign Het
Stpg2 T C 3: 139,298,496 F278S probably damaging Het
Tmem2 G A 19: 21,844,711 A1157T probably benign Het
Tmem240 T C 4: 155,739,778 probably benign Het
Vmn2r22 A G 6: 123,650,625 L4P possibly damaging Het
Vmn2r95 C T 17: 18,441,482 Q497* probably null Het
Wnk1 T C 6: 119,992,453 H347R probably damaging Het
Zmym2 A T 14: 56,919,349 probably benign Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7427:Kif13b UTSW 14 64788460 missense probably benign
R7428:Kif13b UTSW 14 64788460 missense probably benign
R7573:Kif13b UTSW 14 64803658 missense probably benign 0.00
R7629:Kif13b UTSW 14 64779335 nonsense probably null
R7683:Kif13b UTSW 14 64757507 missense probably benign 0.24
R7835:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7895:Kif13b UTSW 14 64736149 missense probably damaging 1.00
R7918:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7978:Kif13b UTSW 14 64736149 missense probably damaging 1.00
Z1176:Kif13b UTSW 14 64803344 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGCTCCAAGTCTTACCAGC -3'
(R):5'- TTGTCACAGGGTGTCCTAATCC -3'

Sequencing Primer
(F):5'- AAGTCTTACCAGCTTCGACATGGG -3'
(R):5'- ACAGGGTGTCCTAATCCTAGCC -3'
Posted On2015-03-18