Incidental Mutation 'R3755:Tssk2'
ID271412
Institutional Source Beutler Lab
Gene Symbol Tssk2
Ensembl Gene ENSMUSG00000045521
Gene Nametestis-specific serine kinase 2
SynonymsDGS-G, SPOGA2, Stk22b, Tsk2
MMRRC Submission 040738-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R3755 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17898637-17900024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17898963 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 77 (E77K)
Ref Sequence ENSEMBL: ENSMUSP00000051035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003621] [ENSMUST00000046937] [ENSMUST00000055374] [ENSMUST00000155943] [ENSMUST00000232423]
Predicted Effect probably benign
Transcript: ENSMUST00000003621
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046937
SMART Domains Protein: ENSMUSP00000040302
Gene: ENSMUSG00000041566

DomainStartEndE-ValueType
S_TKc 12 272 3.86e-89 SMART
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055374
AA Change: E77K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051035
Gene: ENSMUSG00000045521
AA Change: E77K

DomainStartEndE-ValueType
S_TKc 12 272 1.39e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126919
Predicted Effect probably benign
Transcript: ENSMUST00000155943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232366
Predicted Effect probably benign
Transcript: ENSMUST00000232423
Meta Mutation Damage Score 0.4529 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TSSK2 belongs to a family of serine/threonine kinases highly expressed in testis (Hao et al., 2004 [PubMed 15044604]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele of Tssk1 and 2 are infertile due to arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,222,114 S169Y probably damaging Het
Abcb1a G A 5: 8,747,403 V1225M possibly damaging Het
Adamdec1 A T 14: 68,577,138 I130N probably damaging Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Bace2 C G 16: 97,436,657 T436R probably benign Het
Capn13 G A 17: 73,331,119 Q430* probably null Het
Ccdc30 A T 4: 119,367,808 probably null Het
Ces5a T C 8: 93,528,502 T184A probably benign Het
Cntnap5c T C 17: 58,104,599 C493R possibly damaging Het
Creb3l2 A T 6: 37,364,026 I146N possibly damaging Het
Erich3 A G 3: 154,764,321 probably benign Het
Etl4 G A 2: 20,743,537 V27I probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fsip2 G A 2: 82,978,217 D1627N probably benign Het
Gcdh A G 8: 84,893,480 probably benign Het
Kcna7 T C 7: 45,408,945 F219L probably benign Het
Kdm3b T C 18: 34,808,296 L280S probably benign Het
Knl1 T A 2: 119,102,579 V2073D probably damaging Het
Kprp A G 3: 92,825,039 S235P unknown Het
Lpp A G 16: 24,845,161 H396R probably benign Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mcm9 T C 10: 53,625,952 N179S probably benign Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Nfib A T 4: 82,323,699 S418R probably damaging Het
Olfr283 A C 15: 98,378,582 I176S probably benign Het
Olfr690 A G 7: 105,330,151 F14L probably damaging Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pkd1l3 C T 8: 109,632,539 T844I probably damaging Het
Pkhd1l1 A T 15: 44,589,406 E3909V probably damaging Het
Poldip3 A G 15: 83,131,475 probably benign Het
Ptpn1 T C 2: 167,974,223 I219T probably damaging Het
Rad18 T C 6: 112,693,471 N44S probably damaging Het
Reep5 T C 18: 34,372,474 Y48C probably damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Slamf1 C T 1: 171,777,160 A166V probably damaging Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Snap23 T A 2: 120,586,245 C79S probably damaging Het
Spag6l A C 16: 16,763,020 probably null Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Trav4-3 C A 14: 53,599,139 S20R probably benign Het
Ubap2 A G 4: 41,195,482 F1051S probably damaging Het
Ugt3a2 A G 15: 9,367,412 T414A probably benign Het
Urod C T 4: 116,993,404 C66Y probably damaging Het
Vmn1r234 A G 17: 21,229,009 K62E probably damaging Het
Wiz A G 17: 32,359,132 S460P probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb7a C T 10: 81,144,266 T98M probably damaging Het
Zfp524 C A 7: 5,017,885 H137Q probably damaging Het
Other mutations in Tssk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tssk2 APN 16 17898958 missense probably benign 0.02
IGL02117:Tssk2 APN 16 17899789 missense probably benign 0.00
R0195:Tssk2 UTSW 16 17899575 missense probably benign 0.01
R0674:Tssk2 UTSW 16 17899066 missense probably benign 0.01
R2202:Tssk2 UTSW 16 17898739 missense possibly damaging 0.89
R2204:Tssk2 UTSW 16 17898739 missense possibly damaging 0.89
R5427:Tssk2 UTSW 16 17898865 missense probably damaging 1.00
R6245:Tssk2 UTSW 16 17898948 missense possibly damaging 0.81
R6919:Tssk2 UTSW 16 17899701 missense probably benign
R7324:Tssk2 UTSW 16 17899363 missense possibly damaging 0.83
R7837:Tssk2 UTSW 16 17898751 missense possibly damaging 0.51
R7920:Tssk2 UTSW 16 17898751 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GAATCAATCTGGGCAAGGGC -3'
(R):5'- AAGTCCTTGTCAAGCAGAAGGTTC -3'

Sequencing Primer
(F):5'- GGGCTCCTACGCAAAAGTC -3'
(R):5'- GTCAAGCAGAAGGTTCTCACATTTG -3'
Posted On2015-03-18