Incidental Mutation 'R5427:Tssk2'
ID426979
Institutional Source Beutler Lab
Gene Symbol Tssk2
Ensembl Gene ENSMUSG00000045521
Gene Nametestis-specific serine kinase 2
SynonymsDGS-G, SPOGA2, Stk22b, Tsk2
MMRRC Submission 042993-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.576) question?
Stock #R5427 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17898637-17900024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17898865 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000051035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003621] [ENSMUST00000046937] [ENSMUST00000055374] [ENSMUST00000155943] [ENSMUST00000232423]
Predicted Effect probably benign
Transcript: ENSMUST00000003621
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046937
SMART Domains Protein: ENSMUSP00000040302
Gene: ENSMUSG00000041566

DomainStartEndE-ValueType
S_TKc 12 272 3.86e-89 SMART
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055374
AA Change: D44G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051035
Gene: ENSMUSG00000045521
AA Change: D44G

DomainStartEndE-ValueType
S_TKc 12 272 1.39e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126919
Predicted Effect probably benign
Transcript: ENSMUST00000155943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232366
Predicted Effect probably benign
Transcript: ENSMUST00000232423
Meta Mutation Damage Score 0.3975 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TSSK2 belongs to a family of serine/threonine kinases highly expressed in testis (Hao et al., 2004 [PubMed 15044604]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele of Tssk1 and 2 are infertile due to arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,596 C128Y probably benign Het
Aaas A G 15: 102,339,950 V277A possibly damaging Het
Adcy7 G A 8: 88,326,201 probably null Het
Adgrg5 A T 8: 94,935,102 D157V probably benign Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Alpi T C 1: 87,101,354 N33D probably benign Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Anp32a A G 9: 62,377,316 probably benign Het
Atg4b G C 1: 93,775,206 K86N probably damaging Het
Bbx T C 16: 50,280,497 T12A probably benign Het
Catsperg2 T C 7: 29,714,850 T377A possibly damaging Het
Ccdc158 T C 5: 92,648,962 Q505R probably damaging Het
Cep135 T A 5: 76,638,202 S1051T probably benign Het
Cryab A G 9: 50,756,293 D109G probably damaging Het
Crym A C 7: 120,199,222 probably benign Het
Csf2rb2 T A 15: 78,288,911 S250C probably damaging Het
Diaph1 A T 18: 37,890,595 V730E unknown Het
Eci3 G T 13: 34,959,948 L65M possibly damaging Het
Erg28 T C 12: 85,819,567 N46D probably damaging Het
Fam89b A G 19: 5,728,791 S127P probably benign Het
Fign A G 2: 63,978,998 Y643H probably damaging Het
Galk2 T C 2: 125,946,821 V265A probably benign Het
Gclm T C 3: 122,266,327 V252A probably damaging Het
Git2 A G 5: 114,730,328 S584P possibly damaging Het
Gm38394 A G 1: 133,657,595 V668A possibly damaging Het
Iqcf3 T C 9: 106,543,860 probably null Het
Kcnk3 A G 5: 30,622,295 T230A possibly damaging Het
Myh10 T C 11: 68,802,931 L1486P probably damaging Het
Myom2 C A 8: 15,113,764 A1006E probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nampt A T 12: 32,834,915 H111L probably benign Het
Nid1 A G 13: 13,483,683 Y671C probably damaging Het
Npy5r G A 8: 66,681,020 R374C probably damaging Het
Olfr1116 A T 2: 87,269,514 K244N probably benign Het
Olfr1487 A T 19: 13,619,350 S20C probably benign Het
Palld C T 8: 61,550,072 C720Y probably benign Het
Pcsk6 C T 7: 66,033,899 T606M probably benign Het
Pfas T C 11: 69,001,153 I176M possibly damaging Het
Pi4kb A G 3: 94,994,207 D395G probably benign Het
Plod3 A T 5: 136,991,788 Y547F probably damaging Het
Pnpo T C 11: 96,943,807 Y21C probably benign Het
Rgs1 A T 1: 144,246,280 C118* probably null Het
Rrnad1 T C 3: 87,924,332 probably benign Het
Slc22a27 A G 19: 7,879,388 probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Sppl2c G A 11: 104,187,867 V498I probably benign Het
Stim2 A T 5: 54,110,939 I448F possibly damaging Het
Sulf1 A T 1: 12,796,912 T107S possibly damaging Het
Tenm3 A G 8: 48,236,564 V1996A probably damaging Het
Timm23 G A 14: 32,189,146 T171I possibly damaging Het
Vmn2r28 A T 7: 5,486,377 Y488N probably damaging Het
Zbtb48 A G 4: 152,020,651 F518S probably damaging Het
Zfp709 A G 8: 71,889,132 E135G probably benign Het
Zfp788 G A 7: 41,649,652 V571I possibly damaging Het
Zfp963 A G 8: 69,743,456 S116P probably benign Het
Other mutations in Tssk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tssk2 APN 16 17898958 missense probably benign 0.02
IGL02117:Tssk2 APN 16 17899789 missense probably benign 0.00
R0195:Tssk2 UTSW 16 17899575 missense probably benign 0.01
R0674:Tssk2 UTSW 16 17899066 missense probably benign 0.01
R2202:Tssk2 UTSW 16 17898739 missense possibly damaging 0.89
R2204:Tssk2 UTSW 16 17898739 missense possibly damaging 0.89
R3755:Tssk2 UTSW 16 17898963 missense probably damaging 0.98
R6245:Tssk2 UTSW 16 17898948 missense possibly damaging 0.81
R6919:Tssk2 UTSW 16 17899701 missense probably benign
R7324:Tssk2 UTSW 16 17899363 missense possibly damaging 0.83
R7837:Tssk2 UTSW 16 17898751 missense possibly damaging 0.51
R7920:Tssk2 UTSW 16 17898751 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ATGAGGACAATGCCTGCTGG -3'
(R):5'- TTGCGTGCCACATCCTCATG -3'

Sequencing Primer
(F):5'- CCGTGTGGGGAGGGGATG -3'
(R):5'- TCGGCACTTGATGAACTCGAG -3'
Posted On2016-09-01