Incidental Mutation 'R3786:BC003331'
ID272239
Institutional Source Beutler Lab
Gene Symbol BC003331
Ensembl Gene ENSMUSG00000006010
Gene NamecDNA sequence BC003331
Synonyms
MMRRC Submission 040753-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R3786 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150361305-150393080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150384531 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 112 (I112T)
Ref Sequence ENSEMBL: ENSMUSP00000107544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006167] [ENSMUST00000094477] [ENSMUST00000097546] [ENSMUST00000097547] [ENSMUST00000111913]
Predicted Effect probably benign
Transcript: ENSMUST00000006167
AA Change: I112T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000006167
Gene: ENSMUSG00000006010
AA Change: I112T

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094477
AA Change: I112T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092050
Gene: ENSMUSG00000006010
AA Change: I112T

DomainStartEndE-ValueType
Pfam:ODR4-like 28 383 2.8e-120 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097546
AA Change: I112T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095152
Gene: ENSMUSG00000006010
AA Change: I112T

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097547
AA Change: I112T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095153
Gene: ENSMUSG00000006010
AA Change: I112T

DomainStartEndE-ValueType
Pfam:ODR4-like 28 209 1.2e-57 PFAM
Pfam:ODR4-like 206 354 3.1e-43 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111913
AA Change: I112T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107544
Gene: ENSMUSG00000006010
AA Change: I112T

DomainStartEndE-ValueType
Pfam:ODR4-like 28 386 7.1e-113 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150615
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 T A 3: 97,159,289 L41Q probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Btbd7 C T 12: 102,838,152 E210K probably benign Het
C1qtnf12 G A 4: 155,965,899 R231H probably damaging Het
Cenpf T A 1: 189,658,337 E1099D probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Dzip3 C A 16: 48,975,543 C155F probably benign Het
Fam161b A T 12: 84,361,690 probably null Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hnrnpl A G 7: 28,811,011 probably benign Het
Itgb1 T A 8: 128,713,358 I176N probably damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Mgat4c A G 10: 102,385,070 H71R probably damaging Het
Misp G A 10: 79,825,961 V71I probably benign Het
Muc2 A G 7: 141,697,347 Q734R probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Myh13 A G 11: 67,327,188 N29S probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neb C A 2: 52,201,915 V5046F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nrg1 A T 8: 31,821,383 V376E probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Ppp1r21 T A 17: 88,577,127 probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Rhoc T C 3: 104,792,687 probably null Het
Robo3 A G 9: 37,422,225 V708A probably damaging Het
Rtcb G T 10: 85,942,594 T395K possibly damaging Het
Rttn A G 18: 89,037,894 T967A probably benign Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Smarca4 A G 9: 21,672,059 H1062R possibly damaging Het
Spatc1l C T 10: 76,563,902 T86I probably benign Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tsc1 A G 2: 28,687,142 D1151G probably damaging Het
Ttll1 T C 15: 83,484,218 D413G probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Wnt16 A G 6: 22,298,022 N296D probably benign Het
Other mutations in BC003331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:BC003331 APN 1 150382338 missense probably benign 0.10
IGL02189:BC003331 APN 1 150372033 missense possibly damaging 0.94
IGL02257:BC003331 APN 1 150386404 missense probably damaging 0.99
IGL02485:BC003331 APN 1 150363489 critical splice donor site probably null
IGL02585:BC003331 APN 1 150363521 missense probably damaging 0.96
IGL02712:BC003331 APN 1 150386356 critical splice donor site probably null
IGL02902:BC003331 APN 1 150384428 critical splice donor site probably null
IGL03014:BC003331 APN 1 150383053 splice site probably benign
IGL03124:BC003331 APN 1 150386425 missense probably benign 0.00
IGL03181:BC003331 APN 1 150363539 missense probably benign 0.06
IGL03344:BC003331 APN 1 150363544 missense probably damaging 0.99
R1170:BC003331 UTSW 1 150386391 missense probably benign 0.00
R1796:BC003331 UTSW 1 150375554 missense probably benign
R1902:BC003331 UTSW 1 150388609 unclassified probably null
R2149:BC003331 UTSW 1 150388559 missense probably benign 0.05
R2155:BC003331 UTSW 1 150382335 missense possibly damaging 0.68
R2375:BC003331 UTSW 1 150390234 critical splice donor site probably null
R3948:BC003331 UTSW 1 150388557 nonsense probably null
R4589:BC003331 UTSW 1 150384487 missense probably benign 0.11
R4590:BC003331 UTSW 1 150386352 splice site probably null
R4815:BC003331 UTSW 1 150374846 missense probably damaging 0.99
R5196:BC003331 UTSW 1 150382389 missense probably damaging 1.00
R5437:BC003331 UTSW 1 150363518 missense probably benign 0.01
R5549:BC003331 UTSW 1 150372158 missense possibly damaging 0.86
R5677:BC003331 UTSW 1 150374837 missense probably damaging 1.00
R5896:BC003331 UTSW 1 150380360 missense probably benign 0.10
R6472:BC003331 UTSW 1 150381522 missense probably benign 0.15
R7108:BC003331 UTSW 1 150382290 missense probably benign 0.01
R7402:BC003331 UTSW 1 150386356 critical splice donor site probably null
R7662:BC003331 UTSW 1 150382294 missense probably benign
R7767:BC003331 UTSW 1 150372037 missense probably benign 0.00
R7810:BC003331 UTSW 1 150392908 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCAGGGTACACTGTGGG -3'
(R):5'- TGCCAACTGGGTAACATCTTC -3'

Sequencing Primer
(F):5'- GTGGTGTGGGCTCATCC -3'
(R):5'- CCAACTGGGTAACATCTTCATTTTTG -3'
Posted On2015-03-25