Incidental Mutation 'R3769:Zfp458'
ID273185
Institutional Source Beutler Lab
Gene Symbol Zfp458
Ensembl Gene ENSMUSG00000055480
Gene Namezinc finger protein 458
SynonymsRslcan-7
MMRRC Submission 040746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3769 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67254918-67278466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67257482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 298 (I298F)
Ref Sequence ENSEMBL: ENSMUSP00000047222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045969] [ENSMUST00000223990] [ENSMUST00000225772]
Predicted Effect probably damaging
Transcript: ENSMUST00000045969
AA Change: I298F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047222
Gene: ENSMUSG00000055480
AA Change: I298F

DomainStartEndE-ValueType
KRAB 5 65 5.27e-32 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 1.03e-2 SMART
ZnF_C2H2 137 159 4.11e-2 SMART
ZnF_C2H2 193 215 2.17e1 SMART
ZnF_C2H2 221 243 2.95e-3 SMART
ZnF_C2H2 249 271 7.9e-4 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.63e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 3.52e-1 SMART
ZnF_C2H2 445 467 4.87e-4 SMART
ZnF_C2H2 473 495 7.26e-3 SMART
ZnF_C2H2 501 523 1.18e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.05e-2 SMART
ZnF_C2H2 585 607 7.78e-3 SMART
ZnF_C2H2 641 663 1.76e-1 SMART
ZnF_C2H2 669 691 5.21e-4 SMART
ZnF_C2H2 697 719 5.14e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223990
Predicted Effect probably damaging
Transcript: ENSMUST00000225772
AA Change: I295F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.2460 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,863 probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
Arhgap23 A T 11: 97,476,106 D1071V probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Ccer1 G A 10: 97,694,552 G359E probably damaging Het
Cdkal1 T C 13: 29,552,403 probably null Het
Celf1 T C 2: 90,998,648 V20A probably damaging Het
Cep350 G A 1: 155,953,204 T318I probably damaging Het
Chn2 A G 6: 54,290,411 D159G probably damaging Het
Chst5 T A 8: 111,889,881 D369V possibly damaging Het
Cmya5 A T 13: 93,096,693 I629K possibly damaging Het
Cplx4 T C 18: 65,969,927 T41A probably benign Het
Ddx3x T C X: 13,290,569 probably benign Het
Dock7 T C 4: 98,970,829 T1409A probably benign Het
Dpy19l4 T C 4: 11,276,868 probably null Het
Fgf10 G T 13: 118,781,547 V124F probably damaging Het
Gm6356 C A 14: 6,971,774 M120I probably benign Het
Gm7964 T A 7: 83,756,130 V76D probably damaging Het
Gm826 A G 2: 160,327,245 V48A unknown Het
Hoxb5 A G 11: 96,303,969 D119G possibly damaging Het
Ifna7 T C 4: 88,816,727 V167A probably damaging Het
Itgb2 T C 10: 77,549,968 V255A possibly damaging Het
Klf3 A G 5: 64,827,217 probably null Het
Mgl2 T C 11: 70,135,833 L128P probably damaging Het
Olfr1378 A G 11: 50,969,558 D180G probably damaging Het
Pdia6 T C 12: 17,270,456 V32A probably damaging Het
Pex6 G T 17: 46,724,385 probably null Het
Pla2g5 C G 4: 138,801,435 C70S probably damaging Het
Pole4 G A 6: 82,622,114 R119C possibly damaging Het
Polr2c G A 8: 94,860,300 A65T probably damaging Het
Ppil2 T C 16: 17,109,668 H20R probably benign Het
Ptpru C T 4: 131,808,424 C414Y probably damaging Het
Rhot2 T C 17: 25,840,547 D407G probably benign Het
Scn5a G A 9: 119,552,076 probably benign Het
Sh3rf3 A G 10: 58,984,191 T275A probably benign Het
Slc27a2 A G 2: 126,567,798 D300G possibly damaging Het
Slc35e1 A T 8: 72,491,870 I155N possibly damaging Het
Slco1a4 A G 6: 141,839,631 Y78H probably damaging Het
Snx15 T A 19: 6,123,954 probably benign Het
Top1 A T 2: 160,721,522 I758F probably damaging Het
U2surp A G 9: 95,493,697 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A G 9: 121,263,700 V157A probably benign Het
Urgcp T C 11: 5,717,000 Y446C probably damaging Het
Vps51 T C 19: 6,076,348 T125A possibly damaging Het
Other mutations in Zfp458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Zfp458 APN 13 67257236 missense probably benign 0.01
IGL01989:Zfp458 APN 13 67259627 missense probably damaging 0.98
IGL02168:Zfp458 APN 13 67258034 missense probably damaging 0.98
IGL02620:Zfp458 APN 13 67257994 missense probably damaging 1.00
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0025:Zfp458 UTSW 13 67257898 missense probably damaging 0.98
R0066:Zfp458 UTSW 13 67259609 nonsense probably null
R0257:Zfp458 UTSW 13 67259642 nonsense probably null
R1218:Zfp458 UTSW 13 67256209 missense probably damaging 0.99
R1292:Zfp458 UTSW 13 67256690 missense probably damaging 1.00
R1490:Zfp458 UTSW 13 67257509 missense probably damaging 1.00
R1664:Zfp458 UTSW 13 67258080 missense possibly damaging 0.95
R2169:Zfp458 UTSW 13 67257049 missense probably damaging 1.00
R5305:Zfp458 UTSW 13 67256318 missense probably benign 0.31
R5364:Zfp458 UTSW 13 67257948 nonsense probably null
R5426:Zfp458 UTSW 13 67257192 nonsense probably null
R5760:Zfp458 UTSW 13 67257789 missense probably damaging 1.00
R6151:Zfp458 UTSW 13 67257598 missense possibly damaging 0.95
R6186:Zfp458 UTSW 13 67257637 missense probably damaging 1.00
R6298:Zfp458 UTSW 13 67256806 missense probably damaging 1.00
R7368:Zfp458 UTSW 13 67257236 missense probably benign 0.01
R7483:Zfp458 UTSW 13 67256914 missense possibly damaging 0.94
R7711:Zfp458 UTSW 13 67259600 missense possibly damaging 0.95
R7921:Zfp458 UTSW 13 67256116 makesense probably null
R7993:Zfp458 UTSW 13 67257170 missense probably damaging 1.00
R8240:Zfp458 UTSW 13 67258126 missense probably damaging 1.00
R8429:Zfp458 UTSW 13 67258088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCACATACTTCACACTTGTATGG -3'
(R):5'- GGCAAGACCTTACATTGTCCATC -3'

Sequencing Primer
(F):5'- ACTTGTATGGTTTCTCTCCTGTATG -3'
(R):5'- ACCCTACCAGTGTGAAGACTTGG -3'
Posted On2015-03-25