Incidental Mutation 'R2169:Zfp458'
ID235681
Institutional Source Beutler Lab
Gene Symbol Zfp458
Ensembl Gene ENSMUSG00000055480
Gene Namezinc finger protein 458
SynonymsRslcan-7
MMRRC Submission 040172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2169 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67254918-67278466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67257049 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 439 (E439G)
Ref Sequence ENSEMBL: ENSMUSP00000153284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045969] [ENSMUST00000223990] [ENSMUST00000225772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045969
AA Change: E442G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047222
Gene: ENSMUSG00000055480
AA Change: E442G

DomainStartEndE-ValueType
KRAB 5 65 5.27e-32 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 1.03e-2 SMART
ZnF_C2H2 137 159 4.11e-2 SMART
ZnF_C2H2 193 215 2.17e1 SMART
ZnF_C2H2 221 243 2.95e-3 SMART
ZnF_C2H2 249 271 7.9e-4 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.63e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 3.52e-1 SMART
ZnF_C2H2 445 467 4.87e-4 SMART
ZnF_C2H2 473 495 7.26e-3 SMART
ZnF_C2H2 501 523 1.18e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.05e-2 SMART
ZnF_C2H2 585 607 7.78e-3 SMART
ZnF_C2H2 641 663 1.76e-1 SMART
ZnF_C2H2 669 691 5.21e-4 SMART
ZnF_C2H2 697 719 5.14e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223990
Predicted Effect probably damaging
Transcript: ENSMUST00000225772
AA Change: E439G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,485,813 T606A probably benign Het
Adtrp T A 13: 41,767,429 S221C possibly damaging Het
Ap1g2 T A 14: 55,099,340 probably null Het
Arhgef5 A T 6: 43,274,420 M702L probably benign Het
Axdnd1 A G 1: 156,418,309 V34A probably damaging Het
Ccdc154 T A 17: 25,170,923 V509E probably damaging Het
Cttnbp2 C T 6: 18,426,097 D761N probably benign Het
Ddx18 A T 1: 121,558,409 probably null Het
Fam241b A T 10: 62,109,966 I4N probably damaging Het
Fam69a A T 5: 107,909,459 L411* probably null Het
Gm5800 T C 14: 51,713,678 K155E possibly damaging Het
Hemgn T A 4: 46,396,417 H273L possibly damaging Het
Hsp90aa1 A G 12: 110,692,734 V543A probably damaging Het
Hspa1l A G 17: 34,977,323 K113E probably benign Het
Hspb2 A G 9: 50,751,715 I38T probably damaging Het
Htt A T 5: 34,877,475 E2021D probably benign Het
Lrpprc C T 17: 84,770,077 R394Q probably benign Het
Lrrc8b T C 5: 105,481,887 Y700H probably damaging Het
Mefv A G 16: 3,710,888 V593A probably benign Het
Mrgprh C T 17: 12,876,969 T32M probably benign Het
Mrpl18 A G 17: 12,913,768 probably null Het
Muc1 A G 3: 89,231,596 E504G probably damaging Het
Ndufa13 G A 8: 69,894,519 A77V probably damaging Het
Olfr952 A G 9: 39,426,358 F238L possibly damaging Het
Pgbd5 T A 8: 124,384,624 probably null Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phyhip T C 14: 70,467,132 F264L possibly damaging Het
Polr3e C T 7: 120,932,137 R176W probably damaging Het
Prkacb C T 3: 146,746,683 probably null Het
Rab19 T G 6: 39,384,041 V41G possibly damaging Het
Rapgef5 A G 12: 117,715,395 Y234C probably benign Het
Slc26a5 T C 5: 21,813,865 T659A probably damaging Het
Slc6a2 G A 8: 92,994,101 V449I probably benign Het
Stab2 A G 10: 86,887,862 S1490P probably damaging Het
Tln1 T C 4: 43,548,005 T713A probably damaging Het
Tmc6 A T 11: 117,769,106 L732Q probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn1r203 A T 13: 22,524,735 K229* probably null Het
Xylt1 G A 7: 117,667,437 G893R probably damaging Het
Ythdf1 A T 2: 180,912,114 S69T probably damaging Het
Zfp114 C T 7: 24,181,084 T285I probably benign Het
Zfp65 G A 13: 67,710,380 T55I probably damaging Het
Zmym1 C T 4: 127,054,203 probably null Het
Other mutations in Zfp458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Zfp458 APN 13 67257236 missense probably benign 0.01
IGL01989:Zfp458 APN 13 67259627 missense probably damaging 0.98
IGL02168:Zfp458 APN 13 67258034 missense probably damaging 0.98
IGL02620:Zfp458 APN 13 67257994 missense probably damaging 1.00
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0025:Zfp458 UTSW 13 67257898 missense probably damaging 0.98
R0066:Zfp458 UTSW 13 67259609 nonsense probably null
R0257:Zfp458 UTSW 13 67259642 nonsense probably null
R1218:Zfp458 UTSW 13 67256209 missense probably damaging 0.99
R1292:Zfp458 UTSW 13 67256690 missense probably damaging 1.00
R1490:Zfp458 UTSW 13 67257509 missense probably damaging 1.00
R1664:Zfp458 UTSW 13 67258080 missense possibly damaging 0.95
R3769:Zfp458 UTSW 13 67257482 missense probably damaging 1.00
R5305:Zfp458 UTSW 13 67256318 missense probably benign 0.31
R5364:Zfp458 UTSW 13 67257948 nonsense probably null
R5426:Zfp458 UTSW 13 67257192 nonsense probably null
R5760:Zfp458 UTSW 13 67257789 missense probably damaging 1.00
R6151:Zfp458 UTSW 13 67257598 missense possibly damaging 0.95
R6186:Zfp458 UTSW 13 67257637 missense probably damaging 1.00
R6298:Zfp458 UTSW 13 67256806 missense probably damaging 1.00
R7368:Zfp458 UTSW 13 67257236 missense probably benign 0.01
R7483:Zfp458 UTSW 13 67256914 missense possibly damaging 0.94
R7711:Zfp458 UTSW 13 67259600 missense possibly damaging 0.95
R7921:Zfp458 UTSW 13 67256116 makesense probably null
R7993:Zfp458 UTSW 13 67257170 missense probably damaging 1.00
R8240:Zfp458 UTSW 13 67258126 missense probably damaging 1.00
R8429:Zfp458 UTSW 13 67258088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACATACTTCACACTTGTAGGGTTTT -3'
(R):5'- TGTGAAGTATGTGGCAAGGC -3'

Sequencing Primer
(F):5'- TGCCACATACTTCACACTTGTAAGG -3'
(R):5'- GGCAAGGCCTTCTATTATCTATCC -3'
Posted On2014-10-01