Incidental Mutation 'R0364:Slk'
ID30253
Institutional Source Beutler Lab
Gene Symbol Slk
Ensembl Gene ENSMUSG00000025060
Gene NameSTE20-like kinase
Synonyms9A2, Stk2, mSLK, Etk4, SLK
MMRRC Submission 038570-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0364 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47579678-47645246 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 47620189 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 527 (L527*)
Ref Sequence ENSEMBL: ENSMUSP00000049977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026043] [ENSMUST00000051691]
Predicted Effect probably null
Transcript: ENSMUST00000026043
AA Change: L527*
SMART Domains Protein: ENSMUSP00000026043
Gene: ENSMUSG00000025060
AA Change: L527*

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 849 928 1.2e-19 PFAM
Pfam:PKK 986 1127 7.4e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000051691
AA Change: L527*
SMART Domains Protein: ENSMUSP00000049977
Gene: ENSMUSG00000025060
AA Change: L527*

DomainStartEndE-ValueType
S_TKc 34 292 3.18e-99 SMART
low complexity region 305 328 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 585 600 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Pfam:PKK 850 988 1.6e-40 PFAM
Pfam:PKK 1018 1158 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136557
Meta Mutation Damage Score 0.9647 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (86/87)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die by E14.5, exhibiting severe developmental defects, impaired neuronal and skeletal muscle development, abnormal placental differentiation and vascularization, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Arhgef12 A T 9: 43,018,401 N199K probably damaging Het
Arpc2 A G 1: 74,236,887 N26S probably null Het
BC017158 C T 7: 128,290,614 R1H probably damaging Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc178 C T 18: 21,915,062 R757H probably damaging Het
Cfap52 A C 11: 67,953,610 I93S possibly damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dnah12 A G 14: 26,724,473 T730A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Endou A T 15: 97,718,973 probably benign Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fbxw17 T C 13: 50,432,441 S40P possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Fyb A G 15: 6,580,791 K282E probably damaging Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Grm5 A G 7: 88,074,386 Y628C probably damaging Het
Hexa A G 9: 59,563,935 N491D probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hpx G T 7: 105,596,264 Q101K probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b A T 8: 81,997,314 T492S probably benign Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Itga9 A G 9: 118,841,142 T177A probably benign Het
Itpkc A C 7: 27,227,749 S247A possibly damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Kiz T G 2: 146,942,156 S536R probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Kprp A T 3: 92,824,335 Y469* probably null Het
Ksr1 A T 11: 79,029,025 probably benign Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Ltf A T 9: 111,025,167 N350I probably benign Het
Msl3l2 G A 10: 56,115,851 R224Q possibly damaging Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Necap1 A G 6: 122,880,769 probably benign Het
Nf1 A T 11: 79,441,957 K810* probably null Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr850 G A 9: 19,477,972 Q90* probably null Het
Olfr889 A G 9: 38,116,029 T78A probably benign Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Pcdhb17 C A 18: 37,485,835 A226E possibly damaging Het
Phldb1 A T 9: 44,699,335 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Prr14 G A 7: 127,474,579 R205H probably benign Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Slc7a5 A G 8: 121,885,015 F425L probably benign Het
Stpg4 T A 17: 87,389,714 probably null Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tas2r123 T A 6: 132,847,681 S180R probably benign Het
Tmc2 C T 2: 130,202,103 R86W probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz1 A T 18: 84,016,124 I53N probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Ttll7 C A 3: 146,945,181 R719S possibly damaging Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vps39 T G 2: 120,345,638 K76T probably damaging Het
Wdr60 A G 12: 116,257,477 probably benign Het
Whamm A G 7: 81,594,051 T674A probably benign Het
Zbtb16 A G 9: 48,743,576 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Slk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Slk APN 19 47619709 missense probably benign 0.00
IGL00515:Slk APN 19 47642096 unclassified probably benign
IGL00755:Slk APN 19 47609010 missense probably damaging 0.99
IGL00990:Slk APN 19 47580252 missense probably damaging 0.98
IGL02283:Slk APN 19 47641993 missense probably damaging 1.00
R0140:Slk UTSW 19 47622335 missense probably damaging 1.00
R0944:Slk UTSW 19 47608993 missense probably damaging 1.00
R1756:Slk UTSW 19 47622677 missense probably damaging 0.97
R1795:Slk UTSW 19 47620534 missense possibly damaging 0.72
R1869:Slk UTSW 19 47625452 missense probably damaging 1.00
R1980:Slk UTSW 19 47611989 missense probably damaging 1.00
R2261:Slk UTSW 19 47637352 missense probably damaging 0.99
R2278:Slk UTSW 19 47619749 missense probably damaging 0.97
R3746:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3748:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3749:Slk UTSW 19 47619809 missense possibly damaging 0.88
R3750:Slk UTSW 19 47619809 missense possibly damaging 0.88
R4024:Slk UTSW 19 47622370 splice site probably null
R4471:Slk UTSW 19 47615423 missense probably damaging 1.00
R4647:Slk UTSW 19 47620274 missense possibly damaging 0.71
R4825:Slk UTSW 19 47619956 missense probably benign
R5205:Slk UTSW 19 47625460 missense possibly damaging 0.91
R5228:Slk UTSW 19 47625332 missense probably damaging 1.00
R5372:Slk UTSW 19 47625393 missense probably damaging 1.00
R5665:Slk UTSW 19 47636457 missense probably damaging 1.00
R5688:Slk UTSW 19 47620012 missense probably benign 0.00
R5859:Slk UTSW 19 47609042 missense probably benign 0.37
R6279:Slk UTSW 19 47642004 missense probably damaging 1.00
R6368:Slk UTSW 19 47620183 missense possibly damaging 0.85
R6431:Slk UTSW 19 47620888 missense probably damaging 1.00
R6563:Slk UTSW 19 47636469 critical splice donor site probably null
R6705:Slk UTSW 19 47609059 missense probably benign 0.01
R6790:Slk UTSW 19 47635568 missense probably damaging 0.96
R7495:Slk UTSW 19 47638978 missense probably damaging 1.00
R7598:Slk UTSW 19 47636462 missense probably damaging 1.00
R7728:Slk UTSW 19 47620816 missense probably damaging 1.00
R7850:Slk UTSW 19 47622357 missense probably damaging 1.00
R7860:Slk UTSW 19 47642071 missense possibly damaging 0.65
R7911:Slk UTSW 19 47615229 missense
R7933:Slk UTSW 19 47622357 missense probably damaging 1.00
R7943:Slk UTSW 19 47642071 missense possibly damaging 0.65
R7992:Slk UTSW 19 47615229 missense
X0052:Slk UTSW 19 47620933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACACAAGACCAGCAAACTGTGGATG -3'
(R):5'- ATTGGACTCGCTGACCTGCTCAAC -3'

Sequencing Primer
(F):5'- CACTGATTGTCTGAAACCAGAG -3'
(R):5'- ACCAGGAGGCTCTTCCTCAG -3'
Posted On2013-04-24