Incidental Mutation 'R3940:S100a10'
ID307402
Institutional Source Beutler Lab
Gene Symbol S100a10
Ensembl Gene ENSMUSG00000041959
Gene NameS100 calcium binding protein A10 (calpactin)
SynonymsCLP11, Cal1l, p10, 42C, CAL12
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R3940 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93555080-93564643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93561076 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 38 (E38G)
Ref Sequence ENSEMBL: ENSMUSP00000130712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045756] [ENSMUST00000170612]
Predicted Effect probably benign
Transcript: ENSMUST00000045756
AA Change: E38G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036949
Gene: ENSMUSG00000041959
AA Change: E38G

DomainStartEndE-ValueType
Pfam:S_100 5 45 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148400
Predicted Effect probably benign
Transcript: ENSMUST00000170612
AA Change: E38G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130712
Gene: ENSMUSG00000041959
AA Change: E38G

DomainStartEndE-ValueType
Pfam:S_100 5 44 5.2e-18 PFAM
Meta Mutation Damage Score 0.5293 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in exocytosis and endocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a depression-like phenotype, decreased responsiveness to 5-HT1B receptor agonists, and reduced behavioral reactions to an antidepressant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pik3ip1 A G 11: 3,331,987 N48S probably damaging Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in S100a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1870:S100a10 UTSW 3 93561070 missense probably benign 0.08
R2162:S100a10 UTSW 3 93564373 missense probably damaging 0.98
R3831:S100a10 UTSW 3 93564373 missense probably damaging 0.98
R3833:S100a10 UTSW 3 93564373 missense probably damaging 0.98
R5116:S100a10 UTSW 3 93560940 splice site probably null
R7553:S100a10 UTSW 3 93564295 missense probably benign 0.00
RF011:S100a10 UTSW 3 93564234 critical splice acceptor site probably benign
Z1177:S100a10 UTSW 3 93555168 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGATTAGACCTTCTGCTTTC -3'
(R):5'- CCTCATGATGTGCCAATGGG -3'

Sequencing Primer
(F):5'- CTGTCTAAAGATTTTCATACCTGTGG -3'
(R):5'- TCACCTGCAGATTGAGAGTTC -3'
Posted On2015-04-17