Incidental Mutation 'R3940:Pik3ip1'
ID307417
Institutional Source Beutler Lab
Gene Symbol Pik3ip1
Ensembl Gene ENSMUSG00000034614
Gene Namephosphoinositide-3-kinase interacting protein 1
Synonyms
MMRRC Submission 040922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R3940 (G1)
Quality Score157
Status Validated
Chromosome11
Chromosomal Location3330401-3342971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3331987 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 48 (N48S)
Ref Sequence ENSEMBL: ENSMUSP00000091100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045153] [ENSMUST00000093399] [ENSMUST00000136474] [ENSMUST00000136536]
Predicted Effect probably damaging
Transcript: ENSMUST00000045153
AA Change: N48S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036921
Gene: ENSMUSG00000034614
AA Change: N48S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KR 23 103 3.64e-17 SMART
transmembrane domain 170 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093399
AA Change: N48S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091100
Gene: ENSMUSG00000034614
AA Change: N48S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KR 23 103 3.64e-17 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130747
Predicted Effect probably benign
Transcript: ENSMUST00000136474
SMART Domains Protein: ENSMUSP00000119106
Gene: ENSMUSG00000034614

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136536
AA Change: N48S

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122407
Gene: ENSMUSG00000034614
AA Change: N48S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KR 23 103 1.1e-16 SMART
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138907
SMART Domains Protein: ENSMUSP00000121277
Gene: ENSMUSG00000034614

DomainStartEndE-ValueType
KR 1 41 7.93e-3 SMART
transmembrane domain 108 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155332
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (35/37)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Acsm3 A G 7: 119,773,886 E204G probably benign Het
Acta2 A T 19: 34,243,480 I276N possibly damaging Het
Ankrd16 T C 2: 11,784,381 C260R probably benign Het
Ankrd42 T C 7: 92,591,788 probably null Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Calm5 A T 13: 3,854,485 I37F possibly damaging Het
Casq1 A G 1: 172,219,536 V52A possibly damaging Het
Col22a1 A T 15: 71,981,933 L260* probably null Het
Cttnbp2 C A 6: 18,420,975 V846L probably benign Het
Dnah12 A G 14: 26,723,599 T627A probably benign Het
Eogt T C 6: 97,113,914 I421M probably damaging Het
Fam135a T A 1: 24,057,475 H63L probably damaging Het
Fmo3 T A 1: 162,963,986 T241S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gm14393 T C 2: 175,061,627 probably null Het
Kcna5 C T 6: 126,533,651 V505I probably damaging Het
Kit A G 5: 75,609,318 D130G probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Olfr1090 T A 2: 86,753,931 D269V possibly damaging Het
Olfr57 T A 10: 79,035,204 I136N probably damaging Het
Pcdhb7 T C 18: 37,343,968 L719P probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pkn2 G A 3: 142,793,911 S951L probably damaging Het
Prrc2a T C 17: 35,157,498 H772R possibly damaging Het
Ric1 T C 19: 29,570,762 Y277H probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf123 A T 9: 108,064,035 probably benign Het
Robo1 T C 16: 73,009,743 S1166P probably benign Het
S100a10 A G 3: 93,561,076 E38G probably benign Het
Slc34a1 A T 13: 55,413,170 I483F probably damaging Het
Stim1 A G 7: 102,435,641 N600S probably benign Het
Ube3c T A 5: 29,619,360 N517K probably benign Het
Other mutations in Pik3ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03030:Pik3ip1 APN 11 3333259 missense possibly damaging 0.92
R1892:Pik3ip1 UTSW 11 3333304 missense probably damaging 1.00
R4610:Pik3ip1 UTSW 11 3333327 missense probably damaging 1.00
R4818:Pik3ip1 UTSW 11 3330928 unclassified probably benign
R5032:Pik3ip1 UTSW 11 3333520 missense probably damaging 0.99
R6786:Pik3ip1 UTSW 11 3332124 missense probably benign 0.15
R7538:Pik3ip1 UTSW 11 3333558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTGCAGCGATCTTAAGC -3'
(R):5'- GGAGATAGCTCTGGCCAATC -3'

Sequencing Primer
(F):5'- TTGTGTGTGGACCAAACGCC -3'
(R):5'- AGTACCTGGGCAACTCACGTC -3'
Posted On2015-04-17