Incidental Mutation 'R4037:Metrn'
ID313774
Institutional Source Beutler Lab
Gene Symbol Metrn
Ensembl Gene ENSMUSG00000002274
Gene Namemeteorin, glial cell differentiation regulator
Synonyms1810034B16Rik
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4037 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25794571-25797136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25795010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 281 (T281A)
Ref Sequence ENSEMBL: ENSMUSP00000127275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002344] [ENSMUST00000072735] [ENSMUST00000095500] [ENSMUST00000165838]
Predicted Effect probably benign
Transcript: ENSMUST00000002344
AA Change: T281A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002344
Gene: ENSMUSG00000002274
AA Change: T281A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072735
SMART Domains Protein: ENSMUSP00000072518
Gene: ENSMUSG00000057411

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1f3la_ 65 141 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165838
AA Change: T281A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127275
Gene: ENSMUSG00000002274
AA Change: T281A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meteorin regulates glial cell differentiation and promotes the formation of axonal networks during neurogenesis (Nishino et al., 2004 [PubMed 15085178]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Capn6 A G X: 143,807,863 W291R probably damaging Het
Cdc27 T C 11: 104,507,207 I776V probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ruvbl1 T A 6: 88,473,135 M96K probably damaging Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Metrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0008:Metrn UTSW 17 25796505 missense possibly damaging 0.94
R0280:Metrn UTSW 17 25795135 missense probably benign 0.08
R0729:Metrn UTSW 17 25796228 splice site probably benign
R1523:Metrn UTSW 17 25794977 makesense probably null
R2119:Metrn UTSW 17 25795223 missense probably benign 0.03
R2146:Metrn UTSW 17 25796627 missense probably damaging 0.99
R4036:Metrn UTSW 17 25795010 missense probably benign
R4038:Metrn UTSW 17 25795010 missense probably benign
R4230:Metrn UTSW 17 25796941 unclassified probably benign
R5074:Metrn UTSW 17 25796639 missense probably damaging 1.00
R5259:Metrn UTSW 17 25796540 missense probably damaging 1.00
R5686:Metrn UTSW 17 25795217 missense probably damaging 1.00
R5744:Metrn UTSW 17 25795237 missense probably damaging 1.00
R7707:Metrn UTSW 17 25795410 missense probably benign 0.17
R8108:Metrn UTSW 17 25795030 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACCATGACTACAGTGGCTGG -3'
(R):5'- CAGACACTGCCACTGTTCAAG -3'

Sequencing Primer
(F):5'- CCATGACTACAGTGGCTGGTATGG -3'
(R):5'- CACTGCCACTGTTCAAGGAAGG -3'
Posted On2015-04-30