Incidental Mutation 'R4059:Tnip1'
ID 314396
Institutional Source Beutler Lab
Gene Symbol Tnip1
Ensembl Gene ENSMUSG00000020400
Gene Name TNFAIP3 interacting protein 1
Synonyms ABIN1, VAN, A20-binding inhibitor of NF-kappa B activation, Nef
MMRRC Submission 040970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4059 (G1)
Quality Score 220
Status Validated
Chromosome 11
Chromosomal Location 54910785-54962917 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54911569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 638 (S638P)
Ref Sequence ENSEMBL: ENSMUSP00000104517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018482] [ENSMUST00000082430] [ENSMUST00000102730] [ENSMUST00000102731] [ENSMUST00000108885] [ENSMUST00000108886] [ENSMUST00000108889] [ENSMUST00000125094] [ENSMUST00000149324]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018482
AA Change: S638P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000018482
Gene: ENSMUSG00000020400
AA Change: S638P

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082430
SMART Domains Protein: ENSMUSP00000081011
Gene: ENSMUSG00000018339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 4.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102730
SMART Domains Protein: ENSMUSP00000099791
Gene: ENSMUSG00000020400

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 3e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102731
AA Change: S638P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000099792
Gene: ENSMUSG00000020400
AA Change: S638P

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108885
AA Change: S585P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104513
Gene: ENSMUSG00000020400
AA Change: S585P

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108886
AA Change: S585P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104514
Gene: ENSMUSG00000020400
AA Change: S585P

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
coiled coil region 162 213 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SCOP:d1bg1a1 289 458 5e-4 SMART
low complexity region 466 490 N/A INTRINSIC
low complexity region 507 524 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108889
AA Change: S638P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104517
Gene: ENSMUSG00000020400
AA Change: S638P

DomainStartEndE-ValueType
coiled coil region 42 71 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
coiled coil region 215 266 N/A INTRINSIC
low complexity region 284 296 N/A INTRINSIC
SCOP:d1bg1a1 342 511 2e-4 SMART
low complexity region 519 543 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124304
Predicted Effect probably benign
Transcript: ENSMUST00000125094
SMART Domains Protein: ENSMUSP00000119165
Gene: ENSMUSG00000018339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 153 1.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149324
SMART Domains Protein: ENSMUSP00000119882
Gene: ENSMUSG00000018339

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:GSHPx 40 83 1e-13 PFAM
Pfam:GSHPx 99 185 7.3e-28 PFAM
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal lethality associated with anemia and focal apoptosis in the fetal liver. Mice homozygous for a gene trap allele exhibit partial prenatal lethality and SLE-like inflammatory disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Agbl3 T C 6: 34,846,899 L833P probably damaging Het
Amph T C 13: 19,141,998 S633P probably damaging Het
Aspscr1 T C 11: 120,686,679 V60A probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
BC051019 C T 7: 109,717,995 W163* probably null Het
Capza1 T C 3: 104,825,111 E245G probably damaging Het
Cd81 G T 7: 143,065,293 C18F probably damaging Het
Cfap45 G T 1: 172,538,489 R303L probably benign Het
Commd9 T C 2: 101,895,154 V24A possibly damaging Het
Dennd4a A G 9: 64,911,892 N1742D possibly damaging Het
Dgat1 G T 15: 76,504,171 A182D possibly damaging Het
Dlg4 T C 11: 70,027,083 L64P probably benign Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Epb41l4b C T 4: 57,024,337 probably null Het
Fam13c T C 10: 70,554,508 L533P probably damaging Het
Fjx1 T C 2: 102,450,721 T290A possibly damaging Het
Hid1 C T 11: 115,356,739 E278K probably damaging Het
Hsd3b7 T C 7: 127,801,545 I57T probably damaging Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Itgae A G 11: 73,112,134 K175E probably benign Het
Klhl32 T C 4: 24,792,781 T14A probably damaging Het
Krt23 T C 11: 99,485,788 T181A probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc36 A G 8: 105,427,796 E33G probably damaging Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mocos G A 18: 24,679,390 G447D probably damaging Het
Ngef T A 1: 87,486,231 K399N probably damaging Het
Ntrk1 A G 3: 87,781,479 L589P probably damaging Het
Olfr1199 C T 2: 88,756,451 V75I probably benign Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Peg10 T G 6: 4,756,427 probably benign Het
Pkhd1l1 C T 15: 44,550,760 H2808Y probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Ptcd2 A G 13: 99,344,576 C32R probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhoh G A 5: 65,892,588 S67N probably benign Het
Rnd3 A G 2: 51,148,748 F43L probably damaging Het
Runx1 A G 16: 92,644,246 V225A probably benign Het
Runx1t1 T C 4: 13,889,769 V566A probably benign Het
Sall2 A G 14: 52,314,571 I387T probably damaging Het
Sec14l1 T A 11: 117,149,198 V384D possibly damaging Het
Sh3rf3 T C 10: 59,083,533 C491R probably damaging Het
Slc22a27 T A 19: 7,879,608 probably benign Het
Spire1 A G 18: 67,545,713 S53P probably damaging Het
Tmco3 A G 8: 13,320,848 R671G probably benign Het
Tmpo A G 10: 91,162,261 S555P probably benign Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Ucp3 T C 7: 100,482,664 Y241H probably damaging Het
Vmn2r96 A G 17: 18,598,077 I831V probably benign Het
Zan T C 5: 137,436,820 I2104V unknown Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Zfp715 T C 7: 43,301,731 M48V probably benign Het
Other mutations in Tnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnip1 APN 11 54940817 nonsense probably null
IGL02045:Tnip1 APN 11 54911539 makesense probably null
IGL02227:Tnip1 APN 11 54936471 missense possibly damaging 0.90
IGL03093:Tnip1 APN 11 54940826 nonsense probably null
trinity UTSW 11 54939596 critical splice donor site probably null
R0480:Tnip1 UTSW 11 54937994 missense probably damaging 0.96
R0511:Tnip1 UTSW 11 54917873 missense probably damaging 1.00
R2974:Tnip1 UTSW 11 54933983 unclassified probably benign
R4475:Tnip1 UTSW 11 54939596 critical splice donor site probably null
R4509:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4510:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4511:Tnip1 UTSW 11 54926790 missense probably benign 0.00
R4702:Tnip1 UTSW 11 54924402 missense probably benign 0.03
R4784:Tnip1 UTSW 11 54915539 missense possibly damaging 0.66
R5008:Tnip1 UTSW 11 54937984 missense probably benign 0.01
R5461:Tnip1 UTSW 11 54910799 unclassified probably benign
R6050:Tnip1 UTSW 11 54917877 missense probably damaging 1.00
R6992:Tnip1 UTSW 11 54918716 missense probably benign 0.01
R7198:Tnip1 UTSW 11 54917804 missense probably benign 0.00
R7730:Tnip1 UTSW 11 54937979 missense probably benign 0.00
R8503:Tnip1 UTSW 11 54936465 missense probably benign
R9273:Tnip1 UTSW 11 54916957 missense possibly damaging 0.64
R9680:Tnip1 UTSW 11 54938050 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATGTGAGCCAGCTACCCATC -3'
(R):5'- CTATCTTAGTGAGTGGCAGAGG -3'

Sequencing Primer
(F):5'- GCTACCCATCCCAGCCTC -3'
(R):5'- AGGTGACAAATGGCCTCTTC -3'
Posted On 2015-04-30