Incidental Mutation 'R4118:Nat2'
ID315170
Institutional Source Beutler Lab
Gene Symbol Nat2
Ensembl Gene ENSMUSG00000051147
Gene NameN-acetyltransferase 2 (arylamine N-acetyltransferase)
Synonyms
MMRRC Submission 041631-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R4118 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location67494858-67502584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67501619 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 127 (R127H)
Ref Sequence ENSEMBL: ENSMUSP00000130065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093470] [ENSMUST00000163856]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093470
AA Change: R127H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091181
Gene: ENSMUSG00000051147
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.6e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163856
AA Change: R127H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130065
Gene: ENSMUSG00000051147
AA Change: R127H

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.3e-98 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 92% (55/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Inactivation of this gene does not result in an overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,854 R31G possibly damaging Het
4932414N04Rik C T 2: 68,736,513 R419C probably benign Het
Ankmy1 T C 1: 92,888,696 E232G possibly damaging Het
Arhgef4 A T 1: 34,732,347 K1245M probably damaging Het
Atp2c1 A G 9: 105,466,659 L83P probably damaging Het
Atp9b T C 18: 80,749,829 D1000G possibly damaging Het
Atxn7 T C 14: 14,100,308 S665P probably benign Het
Bbs4 T C 9: 59,330,425 Y212C possibly damaging Het
Cars A G 7: 143,559,647 probably null Het
Cep162 T C 9: 87,204,176 T1032A probably benign Het
Chd7 G A 4: 8,865,831 E668K probably damaging Het
Dek T C 13: 47,088,600 T201A probably benign Het
Depdc5 T A 5: 32,964,635 S1079T probably damaging Het
Etaa1 A T 11: 17,946,180 S646T probably benign Het
Fat1 T C 8: 45,010,437 S1339P probably damaging Het
Fat1 C A 8: 45,050,944 D4491E probably damaging Het
Gmps T C 3: 63,980,194 V29A probably benign Het
Gpr18 T C 14: 121,912,556 E19G probably benign Het
Ipo5 A G 14: 120,938,661 T633A probably benign Het
Jmjd1c T A 10: 67,219,753 S317R probably damaging Het
Lama3 T A 18: 12,450,431 M692K probably benign Het
Lrp12 A T 15: 39,877,965 C451* probably null Het
Lrp2 C T 2: 69,430,262 probably null Het
Myrfl T A 10: 116,828,965 I387F probably damaging Het
Naglu G A 11: 101,074,082 V332I probably benign Het
Otx2 G A 14: 48,659,154 T141I probably benign Het
Paqr9 T A 9: 95,560,899 I314N probably damaging Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Ppm1d A G 11: 85,311,582 D37G probably benign Het
Prdm9 T G 17: 15,544,013 D835A probably benign Het
Ptprq A G 10: 107,711,920 S206P probably benign Het
Rapgef2 A G 3: 79,068,887 probably null Het
Rpgrip1l G A 8: 91,252,907 T969I probably benign Het
Rpp40 A G 13: 35,896,804 Y316H probably damaging Het
Serpinb3d A T 1: 107,079,230 D249E possibly damaging Het
Slc22a29 A C 19: 8,160,529 probably benign Het
Slc35f1 T C 10: 53,089,368 M293T probably damaging Het
Slmap A T 14: 26,482,872 L98H probably damaging Het
Tiam1 C T 16: 89,877,033 probably null Het
Tlr11 A G 14: 50,363,227 Y890C probably damaging Het
Tmem131l T C 3: 83,960,767 T194A probably benign Het
Ubap1 A T 4: 41,371,767 D26V probably damaging Het
Vmn2r91 T A 17: 18,110,096 N547K probably damaging Het
Wiz C T 17: 32,369,357 probably benign Het
Wwp2 A G 8: 107,545,459 T399A probably benign Het
Zfp729b A T 13: 67,592,710 F479I possibly damaging Het
Zswim5 G A 4: 116,986,819 R1018H possibly damaging Het
Other mutations in Nat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Nat2 APN 8 67501541 missense probably damaging 1.00
IGL02341:Nat2 APN 8 67501718 missense possibly damaging 0.46
IGL03010:Nat2 APN 8 67502012 missense probably damaging 1.00
R0112:Nat2 UTSW 8 67501726 nonsense probably null
R0511:Nat2 UTSW 8 67501330 nonsense probably null
R0600:Nat2 UTSW 8 67501267 missense probably damaging 1.00
R0690:Nat2 UTSW 8 67501804 missense probably damaging 1.00
R1865:Nat2 UTSW 8 67501552 missense possibly damaging 0.61
R5456:Nat2 UTSW 8 67501573 missense probably damaging 1.00
R7859:Nat2 UTSW 8 67501350 missense probably damaging 1.00
R7942:Nat2 UTSW 8 67501350 missense probably damaging 1.00
Z1176:Nat2 UTSW 8 67501264 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTCTCCAGGTTAATCATCTGC -3'
(R):5'- TTCAATAGTTCGGGGCTCAAGAG -3'

Sequencing Primer
(F):5'- CTGTACTGGGCTCTGACCAAAC -3'
(R):5'- TTCGGGGCTCAAGAGTAAAG -3'
Posted On2015-05-14