Incidental Mutation 'R4210:Sytl1'
ID319115
Institutional Source Beutler Lab
Gene Symbol Sytl1
Ensembl Gene ENSMUSG00000028860
Gene Namesynaptotagmin-like 1
SynonymsPSGL-1, Slp1
MMRRC Submission 041039-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4210 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133253090-133263113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133253565 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 421 (D421G)
Ref Sequence ENSEMBL: ENSMUSP00000101528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
Predicted Effect probably damaging
Transcript: ENSMUST00000030674
AA Change: D486G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860
AA Change: D486G

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030677
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105908
AA Change: D421G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860
AA Change: D421G

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154911
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased number of acinar zygomen granules in a fasted state that can be released by strong stimuli of the fed state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Sytl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sytl1 APN 4 133258856 splice site probably null
IGL02693:Sytl1 APN 4 133257746 missense probably benign 0.03
IGL02721:Sytl1 APN 4 133258878 missense probably benign 0.25
IGL02975:Sytl1 APN 4 133261032 missense probably benign 0.05
FR4304:Sytl1 UTSW 4 133256993 small deletion probably benign
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0677:Sytl1 UTSW 4 133253225 missense possibly damaging 0.89
R1135:Sytl1 UTSW 4 133256970 missense probably damaging 1.00
R1269:Sytl1 UTSW 4 133256115 missense probably damaging 1.00
R2018:Sytl1 UTSW 4 133256160 missense probably damaging 0.99
R2106:Sytl1 UTSW 4 133257463 missense probably benign 0.00
R3938:Sytl1 UTSW 4 133255624 nonsense probably null
R4970:Sytl1 UTSW 4 133255582 nonsense probably null
R5027:Sytl1 UTSW 4 133256219 intron probably benign
R5325:Sytl1 UTSW 4 133261071 start gained probably benign
R5557:Sytl1 UTSW 4 133259356 missense probably damaging 1.00
R6310:Sytl1 UTSW 4 133260998 missense probably benign 0.34
R8235:Sytl1 UTSW 4 133260946 missense probably damaging 1.00
T0722:Sytl1 UTSW 4 133256851 splice site probably benign
T0722:Sytl1 UTSW 4 133256853 splice site probably benign
T0975:Sytl1 UTSW 4 133256994 small deletion probably benign
Z1176:Sytl1 UTSW 4 133256937 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAGATTATGCATTGTGCCC -3'
(R):5'- ACAGTTATCAGCTTCACGTACG -3'

Sequencing Primer
(F):5'- TGCCCAAGCATCCCGAAC -3'
(R):5'- TCAGGGAACACGGCCATATG -3'
Posted On2015-06-10