Incidental Mutation 'R4210:Rax'
ID319164
Institutional Source Beutler Lab
Gene Symbol Rax
Ensembl Gene ENSMUSG00000024518
Gene Nameretina and anterior neural fold homeobox
Synonymsey1, Rx, E130303K03Rik
MMRRC Submission 041039-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R4210 (G1)
Quality Score165
Status Not validated
Chromosome18
Chromosomal Location65934639-65939089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65935081 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 318 (N318Y)
Ref Sequence ENSEMBL: ENSMUSP00000025396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025396]
Predicted Effect unknown
Transcript: ENSMUST00000025396
AA Change: N318Y
SMART Domains Protein: ENSMUSP00000025396
Gene: ENSMUSG00000024518
AA Change: N318Y

DomainStartEndE-ValueType
low complexity region 128 135 N/A INTRINSIC
HOX 136 198 1.25e-27 SMART
low complexity region 207 253 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
Pfam:OAR 314 334 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181100
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mutants die neonatally with severe brain defects including absence of forebrain/midbrain structures and fail to form eye structures. Homozygous hypomorph mutants are viable, but lack eyes and optic tracts and have hypothalamic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Kel C T 6: 41,698,425 W297* probably null Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Rax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02542:Rax APN 18 65938630 missense possibly damaging 0.68
IGL03290:Rax APN 18 65938160 missense probably damaging 1.00
R4211:Rax UTSW 18 65935081 missense unknown
R5138:Rax UTSW 18 65938318 intron probably benign
R6039:Rax UTSW 18 65935347 missense unknown
R6039:Rax UTSW 18 65935347 missense unknown
R6235:Rax UTSW 18 65935161 missense unknown
R6578:Rax UTSW 18 65938667 missense probably benign 0.02
R7870:Rax UTSW 18 65938213 missense probably benign 0.09
R7953:Rax UTSW 18 65938213 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTCGAAGAGTAGGCGCGAG -3'
(R):5'- CCATGAAGCTGCAGGATTCTCC -3'

Sequencing Primer
(F):5'- AGAGTAGGCGCGAGTGTCC -3'
(R):5'- GCTGCAGGATTCTCCCCTCC -3'
Posted On2015-06-10