Incidental Mutation 'R4210:Kel'
ID319120
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 041039-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4210 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 41698425 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 297 (W297*)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably null
Transcript: ENSMUST00000031899
AA Change: W297*
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: W297*

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C T 2: 68,659,878 probably benign Het
Abl1 T C 2: 31,801,696 Y1076H probably damaging Het
Adamts7 C T 9: 90,194,010 T1265I possibly damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Axin2 T A 11: 108,942,576 I529N possibly damaging Het
Bbof1 T C 12: 84,409,183 M1T probably null Het
BC051142 G T 17: 34,460,283 probably benign Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cmpk2 G T 12: 26,469,571 A74S probably benign Het
Colgalt1 G A 8: 71,622,706 V419I probably benign Het
Crybg3 A G 16: 59,544,051 S2403P probably damaging Het
D930048N14Rik G A 11: 51,654,805 probably benign Het
Dnah7b T A 1: 46,137,418 C733S possibly damaging Het
Drc1 G A 5: 30,347,146 V211M possibly damaging Het
Ephx2 T C 14: 66,084,944 T525A probably damaging Het
Eya4 A G 10: 23,226,800 probably null Het
Foxc1 T C 13: 31,807,707 F167S probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gm6370 C A 5: 146,493,924 F306L possibly damaging Het
Hmgcr A G 13: 96,660,221 V187A probably damaging Het
Igkv9-129 T A 6: 67,840,258 S114R possibly damaging Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Ikzf3 T C 11: 98,490,487 Y89C probably benign Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Iqsec3 T C 6: 121,413,040 probably benign Het
Itga3 C A 11: 95,062,623 V298L probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lbh T A 17: 72,921,183 probably null Het
Lrba G A 3: 86,360,126 G1708S probably damaging Het
Lrig2 C T 3: 104,467,304 V154I probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mast4 A T 13: 102,739,205 F1318L probably damaging Het
Ncam2 T C 16: 81,527,103 V545A probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Olfr263 A T 13: 21,133,437 I221L possibly damaging Het
Olfr430 G A 1: 174,070,008 A237T probably damaging Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Pdlim4 T G 11: 54,055,918 D181A possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Pik3r4 G A 9: 105,650,758 A437T possibly damaging Het
Proser3 G A 7: 30,546,100 probably benign Het
Rax T A 18: 65,935,081 N318Y unknown Het
Rnf152 A G 1: 105,284,352 V160A probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sidt2 T C 9: 45,942,775 T652A probably benign Het
Slc12a7 A G 13: 73,814,843 Y1054C probably damaging Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Sspo C A 6: 48,464,901 H1948Q probably benign Het
Stap2 G T 17: 55,997,827 Y318* probably null Het
Sytl1 T C 4: 133,253,565 D421G probably damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tenm3 C T 8: 48,349,404 G374D probably damaging Het
Terf2 A G 8: 107,079,448 S291P probably damaging Het
Tex16 T A X: 112,120,943 D1046E probably benign Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Tnxb T C 17: 34,710,977 I2895T possibly damaging Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Uxs1 T A 1: 43,750,238 H419L possibly damaging Het
Vmn1r152 A T 7: 22,523,579 T205S possibly damaging Het
Vmn1r79 A G 7: 12,176,488 Y99C possibly damaging Het
Zc3h14 A G 12: 98,785,399 H199R probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfp976 A G 7: 42,616,325 F12S probably damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCATGTCACAGGTGCCTTC -3'
(R):5'- TGGGACTTTAGGCAGAAATGTGAC -3'

Sequencing Primer
(F):5'- ACTCACGGTGCCCCTGATAC -3'
(R):5'- GCCTTCTACCATATAGGCTAGGAG -3'
Posted On2015-06-10