Incidental Mutation 'R4245:Ccdc171'
ID320375
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Namecoiled-coil domain containing 171
Synonyms4930473A06Rik, 4930418J05Rik, A330015D16Rik
MMRRC Submission 041061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R4245 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location83525545-83864670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83554808 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 158 (D158G)
Ref Sequence ENSEMBL: ENSMUSP00000116486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000126429] [ENSMUST00000231339]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053414
AA Change: D158G

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407
AA Change: D158G

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107202
SMART Domains Protein: ENSMUSP00000102820
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 21 125 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125077
AA Change: D158G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407
AA Change: D158G

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126429
SMART Domains Protein: ENSMUSP00000138195
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 91 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000231339
AA Change: D158G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4931408C20Rik T C 1: 26,682,080 N1340D probably benign Het
Acacb A T 5: 114,230,784 T1688S probably damaging Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
C8a A G 4: 104,876,346 V4A probably benign Het
Ccdc184 T A 15: 98,168,869 probably null Het
Cdc23 T C 18: 34,637,047 probably benign Het
Dnah5 A G 15: 28,219,189 N51S probably benign Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dusp27 T C 1: 166,101,116 E309G probably damaging Het
Eepd1 T C 9: 25,594,624 I460T probably benign Het
Fen1 T A 19: 10,200,367 I238F probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5493 A G 17: 22,747,226 E28G probably benign Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mpeg1 C A 19: 12,462,908 Q577K probably damaging Het
Mthfd1 T C 12: 76,301,273 S564P probably damaging Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Ndufs6 A T 13: 73,320,393 D62E probably damaging Het
Olfr18 T C 9: 20,314,333 I196V possibly damaging Het
Olfr313 T C 11: 58,817,778 Y257H probably damaging Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk2 C T 15: 73,231,976 G749D probably benign Het
Rab3il1 A T 19: 10,030,154 D222V probably damaging Het
Radil T C 5: 142,543,791 D50G probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sf3a1 C T 11: 4,167,774 R179C probably damaging Het
Tg T C 15: 66,696,469 V1335A possibly damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vill T A 9: 119,071,291 probably benign Het
Vmn2r79 A G 7: 87,002,416 D341G possibly damaging Het
Wdr59 T C 8: 111,490,364 N272D possibly damaging Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zfp985 A G 4: 147,582,939 K88R probably damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83682324 nonsense probably null
IGL00707:Ccdc171 APN 4 83681155 missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83864249 missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83661810 missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83681195 missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83655578 missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83795242 missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83743018 missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83795308 missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83818090 missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83681378 missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83663517 missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83661709
PIT4445001:Ccdc171 UTSW 4 83661747 missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83696441 splice site probably benign
R0284:Ccdc171 UTSW 4 83549738 missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83635682 missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83681244 missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83661858 missense possibly damaging 0.90
R1495:Ccdc171 UTSW 4 83681095 nonsense probably null
R1741:Ccdc171 UTSW 4 83620839 missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83681284 missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R1801:Ccdc171 UTSW 4 83546895 missense probably benign 0.41
R4204:Ccdc171 UTSW 4 83681155 missense probably benign 0.11
R4502:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83657342 missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83549618 missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83681016 missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83795221 missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83694332 missense probably damaging 1.00
R4926:Ccdc171 UTSW 4 83558592 intron probably benign
R4937:Ccdc171 UTSW 4 83549639 missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83558526 intron probably benign
R5185:Ccdc171 UTSW 4 83663655 missense possibly damaging 0.84
R5210:Ccdc171 UTSW 4 83554856 missense probably damaging 1.00
R5243:Ccdc171 UTSW 4 83604107 missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83693962 missense probably benign 0.00
R5574:Ccdc171 UTSW 4 83693753 missense probably damaging 1.00
R6053:Ccdc171 UTSW 4 83795219 missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83554850 missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83696317 nonsense probably null
R6339:Ccdc171 UTSW 4 83742997 missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83864290 missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83693761 missense probably benign 0.00
R7352:Ccdc171 UTSW 4 83818023 missense possibly damaging 0.82
R7390:Ccdc171 UTSW 4 83818067 missense probably damaging 1.00
R7626:Ccdc171 UTSW 4 83580775 nonsense probably null
R7686:Ccdc171 UTSW 4 83657319 missense unknown
R7705:Ccdc171 UTSW 4 83557956 missense possibly damaging 0.87
R8058:Ccdc171 UTSW 4 83580766 missense probably damaging 0.99
U24488:Ccdc171 UTSW 4 83661717 missense probably damaging 1.00
Z1176:Ccdc171 UTSW 4 83795230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCCATTGGTTAGGATCTTAGACTC -3'
(R):5'- CTGAAGTACAACACAGCAGATATG -3'

Sequencing Primer
(F):5'- TCAGAACTTCAGGGAAAGG -3'
(R):5'- ACAGCAGATATGTAAAAATGCCTC -3'
Posted On2015-06-12