Incidental Mutation 'R5574:Ccdc171'
ID 437095
Institutional Source Beutler Lab
Gene Symbol Ccdc171
Ensembl Gene ENSMUSG00000052407
Gene Name coiled-coil domain containing 171
Synonyms 4930473A06Rik, 4930418J05Rik, A330015D16Rik
MMRRC Submission 043129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R5574 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 83525545-83864670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83693753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 895 (N895I)
Ref Sequence ENSEMBL: ENSMUSP00000056520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053414] [ENSMUST00000125077] [ENSMUST00000231339]
AlphaFold E9Q1U1
Predicted Effect probably damaging
Transcript: ENSMUST00000053414
AA Change: N895I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056520
Gene: ENSMUSG00000052407
AA Change: N895I

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 527 N/A INTRINSIC
coiled coil region 599 628 N/A INTRINSIC
coiled coil region 653 712 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 783 797 N/A INTRINSIC
coiled coil region 981 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125077
SMART Domains Protein: ENSMUSP00000116486
Gene: ENSMUSG00000052407

DomainStartEndE-ValueType
coiled coil region 48 298 N/A INTRINSIC
coiled coil region 325 393 N/A INTRINSIC
coiled coil region 453 535 N/A INTRINSIC
coiled coil region 607 636 N/A INTRINSIC
coiled coil region 661 720 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
coiled coil region 989 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183729
Predicted Effect probably damaging
Transcript: ENSMUST00000231339
AA Change: N903I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0961 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice that either homozygous or heterozygous for an ENU-induced single point mutation exhibit decreased mature B cell number, decreased IgD level, and increased IgM level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T A 14: 59,142,756 N31I possibly damaging Het
3110002H16Rik CTGTGTGTT CTGTGTGTTGTGTGTT 18: 12,185,006 probably null Het
Acvr1b T A 15: 101,202,077 M304K probably benign Het
Adamts1 G T 16: 85,799,642 D106E probably damaging Het
Blm C A 7: 80,499,773 C696F probably damaging Het
Bnip3l-ps T A 12: 18,217,118 noncoding transcript Het
C87499 T G 4: 88,628,043 E354A probably benign Het
Cdhr4 A T 9: 107,993,328 probably benign Het
Cfap97 T C 8: 46,170,142 S190P probably damaging Het
Chrnb1 A C 11: 69,793,683 probably benign Het
Clns1a A G 7: 97,720,958 probably benign Het
Col8a2 G A 4: 126,311,268 probably benign Het
Cr2 T A 1: 195,141,236 E721V probably damaging Het
Csk A G 9: 57,629,301 V172A probably benign Het
Cyp2g1 G A 7: 26,820,740 V466M possibly damaging Het
Cyp4f13 A G 17: 32,929,205 Y349H probably benign Het
Dnm1l T C 16: 16,329,821 Y205C probably damaging Het
Dync1i2 A T 2: 71,233,650 T113S probably benign Het
Edem2 T C 2: 155,716,155 E186G probably damaging Het
Eya2 G A 2: 165,763,816 R380H probably damaging Het
Fam214a A T 9: 75,010,390 D757V probably damaging Het
Fam60a C T 6: 148,944,880 probably benign Het
Gldn A G 9: 54,312,922 T132A probably damaging Het
Gm13941 A T 2: 111,100,606 I74K unknown Het
Gm3898 C T 9: 43,830,042 noncoding transcript Het
Ighmbp2 C T 19: 3,271,536 V408I probably benign Het
Klhdc10 C T 6: 30,439,865 L127F possibly damaging Het
Letm1 G A 5: 33,769,386 T189M possibly damaging Het
Lrrc17 A T 5: 21,570,357 I306F possibly damaging Het
Lrrk2 T A 15: 91,787,016 V2000E probably damaging Het
Mettl9 A T 7: 121,047,870 E66D probably benign Het
Mroh1 T A 15: 76,433,931 V877D probably benign Het
Mycbp2 C T 14: 103,142,767 V3760M possibly damaging Het
Nos3 A G 5: 24,368,861 T208A possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obp2a A T 2: 25,700,830 T70S possibly damaging Het
Olfr1040 T C 2: 86,146,191 D181G probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr1245 C T 2: 89,574,977 V250I possibly damaging Het
Olfr145 A T 9: 37,897,581 Y59F probably damaging Het
Olfr69 T G 7: 103,768,116 I94L possibly damaging Het
Pate2 A G 9: 35,686,115 probably benign Het
Pdzph1 A G 17: 58,973,947 F447L probably benign Het
Pias1 A G 9: 62,920,493 C211R probably damaging Het
Plb1 A G 5: 32,329,947 S929G probably benign Het
Prc1 G A 7: 80,294,542 probably benign Het
Prex2 A G 1: 11,140,058 D574G probably damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rock2 T C 12: 16,961,641 M690T possibly damaging Het
Slc18a2 A G 19: 59,261,405 I25V probably benign Het
Slc9a5 T A 8: 105,364,691 I701K probably benign Het
Sorcs1 T A 19: 50,222,133 N765Y probably damaging Het
Ssh2 A T 11: 77,450,115 I698L probably benign Het
Stam A G 2: 14,115,864 D58G probably damaging Het
Thsd4 C A 9: 59,972,400 R1018L probably damaging Het
Tnxb A G 17: 34,711,024 T2911A probably benign Het
Trpm7 A C 2: 126,813,030 F1329L probably benign Het
Ttll9 A G 2: 152,984,248 E126G possibly damaging Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Unc45a G A 7: 80,334,856 A232V probably damaging Het
Utp14b G A 1: 78,666,409 V675M probably damaging Het
Vmn2r67 T A 7: 85,151,891 H279L probably benign Het
Vmn2r75 G T 7: 86,166,302 A118E probably benign Het
Wdr36 A T 18: 32,865,959 Q886L probably damaging Het
Zfp433 T A 10: 81,719,291 Y27* probably null Het
Zfp715 A T 7: 43,311,039 S43T possibly damaging Het
Zfyve26 A G 12: 79,239,924 S2297P possibly damaging Het
Other mutations in Ccdc171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Ccdc171 APN 4 83682324 nonsense probably null
IGL00707:Ccdc171 APN 4 83681155 missense probably benign 0.11
IGL00907:Ccdc171 APN 4 83864249 missense probably damaging 0.98
IGL01113:Ccdc171 APN 4 83661810 missense probably damaging 1.00
IGL01669:Ccdc171 APN 4 83681195 missense probably damaging 1.00
IGL01696:Ccdc171 APN 4 83655578 missense possibly damaging 0.66
IGL02006:Ccdc171 APN 4 83795242 missense possibly damaging 0.93
IGL02582:Ccdc171 APN 4 83743018 missense probably damaging 1.00
IGL03019:Ccdc171 APN 4 83795308 missense probably damaging 1.00
IGL03144:Ccdc171 APN 4 83818090 missense probably damaging 0.99
IGL03350:Ccdc171 APN 4 83681378 missense possibly damaging 0.67
IGL03377:Ccdc171 APN 4 83663517 missense probably damaging 1.00
PIT4131001:Ccdc171 UTSW 4 83661709
PIT4445001:Ccdc171 UTSW 4 83661747 missense probably damaging 1.00
R0219:Ccdc171 UTSW 4 83696441 splice site probably benign
R0284:Ccdc171 UTSW 4 83549738 missense possibly damaging 0.62
R0355:Ccdc171 UTSW 4 83635682 missense probably damaging 1.00
R1248:Ccdc171 UTSW 4 83681244 missense possibly damaging 0.46
R1278:Ccdc171 UTSW 4 83661858 missense possibly damaging 0.90
R1495:Ccdc171 UTSW 4 83681095 nonsense probably null
R1741:Ccdc171 UTSW 4 83620839 missense probably damaging 0.97
R1742:Ccdc171 UTSW 4 83681284 missense probably damaging 0.99
R1789:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R1801:Ccdc171 UTSW 4 83546895 missense probably benign 0.41
R4204:Ccdc171 UTSW 4 83681155 missense probably benign 0.11
R4245:Ccdc171 UTSW 4 83554808 missense probably damaging 0.99
R4502:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4503:Ccdc171 UTSW 4 83864323 missense probably damaging 1.00
R4533:Ccdc171 UTSW 4 83657342 missense possibly damaging 0.66
R4589:Ccdc171 UTSW 4 83549618 missense probably benign 0.11
R4782:Ccdc171 UTSW 4 83681016 missense probably damaging 0.99
R4815:Ccdc171 UTSW 4 83795221 missense probably damaging 1.00
R4868:Ccdc171 UTSW 4 83694332 missense probably damaging 1.00
R4926:Ccdc171 UTSW 4 83558592 intron probably benign
R4937:Ccdc171 UTSW 4 83549639 missense probably damaging 1.00
R5120:Ccdc171 UTSW 4 83558526 intron probably benign
R5185:Ccdc171 UTSW 4 83663655 missense possibly damaging 0.84
R5210:Ccdc171 UTSW 4 83554856 missense probably damaging 1.00
R5243:Ccdc171 UTSW 4 83604107 missense probably damaging 1.00
R5484:Ccdc171 UTSW 4 83693962 missense probably benign 0.00
R6053:Ccdc171 UTSW 4 83795219 missense probably damaging 1.00
R6135:Ccdc171 UTSW 4 83554850 missense probably benign 0.12
R6140:Ccdc171 UTSW 4 83696317 nonsense probably null
R6339:Ccdc171 UTSW 4 83742997 missense probably damaging 1.00
R6452:Ccdc171 UTSW 4 83864290 missense probably damaging 1.00
R7111:Ccdc171 UTSW 4 83693761 missense probably benign 0.00
R7352:Ccdc171 UTSW 4 83818023 missense possibly damaging 0.82
R7390:Ccdc171 UTSW 4 83818067 missense probably damaging 1.00
R7626:Ccdc171 UTSW 4 83580775 nonsense probably null
R7686:Ccdc171 UTSW 4 83657319 missense unknown
R7705:Ccdc171 UTSW 4 83557956 missense possibly damaging 0.87
R7934:Ccdc171 UTSW 4 83696255 nonsense probably null
R8058:Ccdc171 UTSW 4 83580766 missense probably damaging 0.99
R8114:Ccdc171 UTSW 4 83696300 missense probably damaging 1.00
R8253:Ccdc171 UTSW 4 83742970 missense probably damaging 0.99
R8257:Ccdc171 UTSW 4 83696369 missense probably damaging 1.00
R8378:Ccdc171 UTSW 4 83864253 missense possibly damaging 0.67
R8501:Ccdc171 UTSW 4 83663658 nonsense probably null
R8517:Ccdc171 UTSW 4 83743061 missense probably damaging 1.00
R8697:Ccdc171 UTSW 4 83682340 missense probably damaging 1.00
R9149:Ccdc171 UTSW 4 83694275 missense probably damaging 1.00
R9430:Ccdc171 UTSW 4 83604125 missense probably damaging 1.00
U24488:Ccdc171 UTSW 4 83661717 missense probably damaging 1.00
Z1176:Ccdc171 UTSW 4 83795230 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGTCAGACTGTAAGTTCATGAG -3'
(R):5'- GCCAGCGTGTTCACTTTGTG -3'

Sequencing Primer
(F):5'- GAGCACGGTTCCTCAGTGAGTC -3'
(R):5'- TCACTTTGTGAAGCCCCCGG -3'
Posted On 2016-10-26