Incidental Mutation 'R4167:Krt74'
ID320634
Institutional Source Beutler Lab
Gene Symbol Krt74
Ensembl Gene ENSMUSG00000067596
Gene Namekeratin 74
SynonymsKb37
MMRRC Submission 041008-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4167 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101754259-101763504 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 101758869 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000088018]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088018
SMART Domains Protein: ENSMUSP00000085335
Gene: ENSMUSG00000067596

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 102 9e-21 PFAM
Filament 105 418 6.41e-143 SMART
low complexity region 425 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229279
Meta Mutation Damage Score 0.3429 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casp6 A G 3: 129,913,344 H201R probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cdh16 A G 8: 104,617,730 L59P probably benign Het
Dcp2 T A 18: 44,395,967 Y50N probably damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Fam78b T C 1: 167,001,732 V51A possibly damaging Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Glyctk G T 9: 106,157,762 A35E probably benign Het
Kat14 A G 2: 144,394,110 E254G probably damaging Het
Kcng1 T A 2: 168,262,697 S410C probably damaging Het
Lrp12 T C 15: 39,885,013 T70A probably damaging Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mindy4 G A 6: 55,224,346 G339S possibly damaging Het
Naip1 C T 13: 100,444,286 G151D probably benign Het
Ndufaf7 G A 17: 78,944,986 V275I probably benign Het
Nppb T A 4: 147,986,974 L121* probably null Het
Olfr111 T C 17: 37,530,006 S10P possibly damaging Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Oog2 A T 4: 144,196,212 Q349L probably benign Het
Pcdhgb8 T G 18: 37,762,543 V222G possibly damaging Het
Plcd3 A T 11: 103,078,464 C226S probably damaging Het
Plxdc2 A G 2: 16,565,385 E125G probably damaging Het
Rnf213 A G 11: 119,441,243 E2426G probably damaging Het
Rraga T C 4: 86,576,067 V50A possibly damaging Het
Scmh1 T C 4: 120,529,276 probably benign Het
Slc9a9 A G 9: 95,228,899 Y590C probably damaging Het
Snx20 C T 8: 88,627,385 R239Q probably benign Het
Vmn2r59 A G 7: 42,021,308 probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Other mutations in Krt74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Krt74 APN 15 101756794 exon noncoding transcript
IGL02376:Krt74 APN 15 101754503 exon noncoding transcript
IGL02507:Krt74 APN 15 101760624 exon noncoding transcript
IGL03374:Krt74 APN 15 101760502 splice site noncoding transcript
R0032:Krt74 UTSW 15 101761452 exon noncoding transcript
R0032:Krt74 UTSW 15 101761452 exon noncoding transcript
R0110:Krt74 UTSW 15 101763316 exon noncoding transcript
R0450:Krt74 UTSW 15 101763316 exon noncoding transcript
R0469:Krt74 UTSW 15 101763316 exon noncoding transcript
R0510:Krt74 UTSW 15 101763316 exon noncoding transcript
R0550:Krt74 UTSW 15 101760679 splice site noncoding transcript
R0558:Krt74 UTSW 15 101760963 exon noncoding transcript
R1663:Krt74 UTSW 15 101756674 exon noncoding transcript
R2392:Krt74 UTSW 15 101756801 splice site noncoding transcript
R3772:Krt74 UTSW 15 101762195 exon noncoding transcript
R4670:Krt74 UTSW 15 101758869 exon noncoding transcript
R4741:Krt74 UTSW 15 101761441 exon noncoding transcript
R5470:Krt74 UTSW 15 101754465 exon noncoding transcript
R5639:Krt74 UTSW 15 101756760 exon noncoding transcript
R5664:Krt74 UTSW 15 101760579 exon noncoding transcript
R6274:Krt74 UTSW 15 101763437 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCCAGAGATAGATGGTGTCTTC -3'
(R):5'- CCTGAGTTCCAGCTTCACTG -3'

Sequencing Primer
(F):5'- TCCCCATTCTGATACAAGGTGAG -3'
(R):5'- AGCTTCACTGCCTCCACTTGAG -3'
Posted On2015-06-12