Incidental Mutation 'R4108:Nfe2l1'
ID321487
Institutional Source Beutler Lab
Gene Symbol Nfe2l1
Ensembl Gene ENSMUSG00000038615
Gene Namenuclear factor, erythroid derived 2,-like 1
SynonymsLCR-F1, TCF11, NRF1, TCF-11, Lcrf1
MMRRC Submission 040987-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4108 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96817414-96829968 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 96819394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081775] [ENSMUST00000107657] [ENSMUST00000107658] [ENSMUST00000107659] [ENSMUST00000126949] [ENSMUST00000142065] [ENSMUST00000167110] [ENSMUST00000167149] [ENSMUST00000169828]
Predicted Effect probably benign
Transcript: ENSMUST00000081775
AA Change: V670I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000080467
Gene: ENSMUSG00000038615
AA Change: V670I

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107657
AA Change: V670I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103284
Gene: ENSMUSG00000038615
AA Change: V670I

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107658
AA Change: V670I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103285
Gene: ENSMUSG00000038615
AA Change: V670I

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107659
SMART Domains Protein: ENSMUSP00000103286
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 697 1.93e-7 SMART
transmembrane domain 719 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126949
SMART Domains Protein: ENSMUSP00000120512
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
SCOP:d1e5xa_ 22 65 4e-3 SMART
low complexity region 114 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140138
Predicted Effect probably benign
Transcript: ENSMUST00000142065
SMART Domains Protein: ENSMUSP00000121423
Gene: ENSMUSG00000038615

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167110
AA Change: V512I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127804
Gene: ENSMUSG00000038615
AA Change: V512I

DomainStartEndE-ValueType
PDB:3WN7|M 14 48 1e-9 PDB
low complexity region 244 257 N/A INTRINSIC
low complexity region 287 334 N/A INTRINSIC
BRLZ 463 527 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167149
AA Change: V670I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128527
Gene: ENSMUSG00000038615
AA Change: V670I

DomainStartEndE-ValueType
PDB:3WN7|M 172 206 1e-9 PDB
low complexity region 402 415 N/A INTRINSIC
low complexity region 445 492 N/A INTRINSIC
BRLZ 621 685 9.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169828
AA Change: V382I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131585
Gene: ENSMUSG00000038615
AA Change: V382I

DomainStartEndE-ValueType
low complexity region 114 127 N/A INTRINSIC
low complexity region 157 204 N/A INTRINSIC
BRLZ 333 397 9.8e-9 SMART
Meta Mutation Damage Score 0.0954 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in globin gene expression in erythrocytes. Confusion has occurred in bibliographic databases from the use of NRF1 for this gene, NFE2L1, and for "nuclear respiratory factor 1" which has an official symbol of NRF1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations fail to form a primitive streak, lack mesoderm, show a non-cell autonomous defect in definitive erythropoiesis, and die around embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,225,934 Y82C probably damaging Het
4930579F01Rik T C 3: 138,183,670 N62S probably benign Het
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atp4b A G 8: 13,396,640 probably null Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Caskin1 C A 17: 24,502,147 T487K probably benign Het
Ccr7 C T 11: 99,145,378 M239I probably damaging Het
Cdh23 C A 10: 60,410,822 V944L possibly damaging Het
Cenpf A G 1: 189,683,868 S87P probably damaging Het
Chd9 A T 8: 91,010,676 D1461V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5r2 A T 7: 107,753,929 M102K probably damaging Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Dtx4 G A 19: 12,501,123 A32V probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Eml6 A C 11: 29,805,136 S880A probably damaging Het
Fsd2 C T 7: 81,544,967 V483I probably benign Het
Inf2 T C 12: 112,607,581 L773P unknown Het
Kif26b A G 1: 178,916,965 Q1095R possibly damaging Het
Leprotl1 A G 8: 34,140,759 probably null Het
Lrp1b A G 2: 40,665,087 V340A unknown Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Ncstn G T 1: 172,072,544 N254K probably damaging Het
Nfatc1 T A 18: 80,698,368 H139L possibly damaging Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr11 A G 13: 21,638,782 V247A probably damaging Het
Olfr844 T A 9: 19,319,312 Y265* probably null Het
Otogl C T 10: 107,771,244 V2093I probably benign Het
Phc2 A G 4: 128,707,983 Y77C probably damaging Het
Pik3c2g C A 6: 139,730,370 A80E probably benign Het
Plxnd1 G T 6: 115,959,315 H1675N probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Ppp1r12c T C 7: 4,486,566 D199G probably damaging Het
Prss22 A G 17: 23,993,873 Y297H probably benign Het
Psmb7 T A 2: 38,642,199 H78L probably damaging Het
Rad51ap2 T C 12: 11,458,395 C773R probably damaging Het
Rpl12 A T 2: 32,961,824 N8Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sbf1 T C 15: 89,288,585 probably benign Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1a G A 7: 127,799,202 probably benign Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slc34a2 G A 5: 53,064,009 V266I possibly damaging Het
Smtn G A 11: 3,526,449 T144I probably benign Het
Spta1 A G 1: 174,174,556 N84S probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tbcd T A 11: 121,493,811 H39Q probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tsg101 T A 7: 46,892,494 D99V probably damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Ubald1 C A 16: 4,875,867 M61I probably benign Het
Ush1c C T 7: 46,198,445 D465N probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps54 A G 11: 21,312,877 I655V probably benign Het
Other mutations in Nfe2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Nfe2l1 APN 11 96817716 missense probably benign 0.23
IGL02676:Nfe2l1 APN 11 96827665 missense probably damaging 0.97
IGL02868:Nfe2l1 APN 11 96820140 missense probably damaging 1.00
IGL03278:Nfe2l1 APN 11 96822192 missense probably benign 0.04
R0218:Nfe2l1 UTSW 11 96827613 missense probably damaging 1.00
R0453:Nfe2l1 UTSW 11 96827368 missense probably damaging 0.99
R0637:Nfe2l1 UTSW 11 96827688 missense probably damaging 1.00
R3891:Nfe2l1 UTSW 11 96819997 missense possibly damaging 0.93
R4234:Nfe2l1 UTSW 11 96819909 missense probably damaging 1.00
R4720:Nfe2l1 UTSW 11 96827689 missense probably damaging 1.00
R5102:Nfe2l1 UTSW 11 96822108 missense probably damaging 0.99
R5319:Nfe2l1 UTSW 11 96819379 missense probably damaging 0.98
R5929:Nfe2l1 UTSW 11 96827359 missense probably damaging 0.99
R6263:Nfe2l1 UTSW 11 96817744 missense probably benign 0.23
R6375:Nfe2l1 UTSW 11 96820051 missense probably damaging 1.00
R6450:Nfe2l1 UTSW 11 96827335 missense possibly damaging 0.80
R6705:Nfe2l1 UTSW 11 96827625 missense probably damaging 1.00
R6907:Nfe2l1 UTSW 11 96819810 missense probably damaging 1.00
R7161:Nfe2l1 UTSW 11 96817720 missense probably benign 0.23
R7411:Nfe2l1 UTSW 11 96822183 missense probably benign 0.37
R7420:Nfe2l1 UTSW 11 96819913 missense probably benign 0.02
R7495:Nfe2l1 UTSW 11 96819796 missense probably damaging 0.98
R7625:Nfe2l1 UTSW 11 96819445 missense probably damaging 1.00
R8134:Nfe2l1 UTSW 11 96819759 missense possibly damaging 0.83
R8252:Nfe2l1 UTSW 11 96819232 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGTTTCGGTCTTAGTGAGC -3'
(R):5'- AAATACCAGCTGAGCGAGGC -3'

Sequencing Primer
(F):5'- GTCTTAGTGAGCGTCCACC -3'
(R):5'- GCCCAGCTCAGCCTCATC -3'
Posted On2015-06-12