Incidental Mutation 'R4285:Il1rn'
ID322010
Institutional Source Beutler Lab
Gene Symbol Il1rn
Ensembl Gene ENSMUSG00000026981
Gene Nameinterleukin 1 receptor antagonist
SynonymsF630041P17Rik, IL-1ra
MMRRC Submission 041080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4285 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location24336853-24351494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24349545 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 151 (L151P)
Ref Sequence ENSEMBL: ENSMUSP00000110126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114482] [ENSMUST00000114485] [ENSMUST00000114487] [ENSMUST00000142093]
Predicted Effect probably damaging
Transcript: ENSMUST00000114482
AA Change: L151P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110126
Gene: ENSMUSG00000026981
AA Change: L151P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL1 34 175 2.88e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114485
AA Change: L135P

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110129
Gene: ENSMUSG00000026981
AA Change: L135P

DomainStartEndE-ValueType
IL1 18 159 2.88e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114487
AA Change: L132P

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110131
Gene: ENSMUSG00000026981
AA Change: L132P

DomainStartEndE-ValueType
IL1 15 156 2.88e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142093
SMART Domains Protein: ENSMUSP00000141269
Gene: ENSMUSG00000026981

DomainStartEndE-ValueType
PDB:1IRP|A 8 50 1e-21 PDB
Blast:IL1 15 50 9e-20 BLAST
SCOP:d1ilr1_ 16 50 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143423
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jan 2016]
PHENOTYPE: Nullizygous mutations of this gene may result in decreased body weight, increased inflammatory response to turpentine and LPS, decreased susceptibility to bacterial infection, psoriasis, aortitis, rheumatoid arthritis, and abnormal dendritic and CD4-positive T cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,752 T104A probably benign Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Ahnak T A 19: 9,016,839 C5162* probably null Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cfap73 T C 5: 120,632,589 K39E possibly damaging Het
Coq6 C T 12: 84,370,404 probably benign Het
Dlc1 C T 8: 36,574,128 E1316K possibly damaging Het
Dscam A G 16: 96,709,109 probably null Het
Eya2 T A 2: 165,724,780 N250K probably benign Het
Fat4 A G 3: 38,889,171 I738V probably benign Het
Gria2 T G 3: 80,707,662 probably benign Het
Hnrnph3 A T 10: 63,016,468 D238E probably damaging Het
Kctd19 G A 8: 105,382,949 probably benign Het
Kdm1a T C 4: 136,582,036 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc1 C A 1: 153,234,552 G1126W probably damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Man2a2 T C 7: 80,368,619 D141G probably damaging Het
Map2k1 C A 9: 64,212,643 V127L probably damaging Het
Memo1 T C 17: 74,255,298 probably null Het
Mxd3 A G 13: 55,329,354 S31P probably benign Het
Myo5b G A 18: 74,714,849 E1053K probably benign Het
Olfr164 A C 16: 19,285,964 F260V probably damaging Het
Olfr586 G T 7: 103,122,660 Y37* probably null Het
Pex5l A G 3: 33,007,187 I171T probably damaging Het
Plag1 A G 4: 3,905,654 V12A probably benign Het
Podn C A 4: 108,021,696 V180L possibly damaging Het
Prox2 T A 12: 85,094,924 R168S probably benign Het
Prss29 A G 17: 25,322,257 Y225C probably damaging Het
Rassf2 G A 2: 132,005,394 T97I probably benign Het
Samm50 T C 15: 84,197,012 V47A probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
St6galnac3 A C 3: 153,206,723 V161G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vat1l A G 8: 114,205,783 E23G probably damaging Het
Vmn2r91 A G 17: 18,135,768 T566A probably benign Het
Wls A T 3: 159,934,266 H511L probably benign Het
Zfp644 G A 5: 106,635,118 T1130I probably damaging Het
Other mutations in Il1rn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Il1rn APN 2 24349539 missense probably damaging 1.00
IGL02606:Il1rn APN 2 24345450 intron probably benign
R1251:Il1rn UTSW 2 24345570 missense probably damaging 1.00
R1943:Il1rn UTSW 2 24348599 missense possibly damaging 0.94
R4284:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4287:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R5317:Il1rn UTSW 2 24349542 missense probably benign 0.30
R5322:Il1rn UTSW 2 24348629 critical splice donor site probably null
R6662:Il1rn UTSW 2 24336875 start gained probably null
R7427:Il1rn UTSW 2 24349542 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TAGAGGACTTTCTCAGCCCTC -3'
(R):5'- CTGAGGCAGAGATCTATCATCAG -3'

Sequencing Primer
(F):5'- CGGCAATTACCTGACCATTTCTTGAC -3'
(R):5'- GAGGCAGAGATCTATCATCAGAACTC -3'
Posted On2015-06-20