Incidental Mutation 'R5317:Il1rn'
ID405860
Institutional Source Beutler Lab
Gene Symbol Il1rn
Ensembl Gene ENSMUSG00000026981
Gene Nameinterleukin 1 receptor antagonist
SynonymsF630041P17Rik, IL-1ra
MMRRC Submission 042900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5317 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location24336853-24351494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24349542 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 150 (T150I)
Ref Sequence ENSEMBL: ENSMUSP00000110126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114482] [ENSMUST00000114485] [ENSMUST00000114487] [ENSMUST00000142093]
Predicted Effect probably benign
Transcript: ENSMUST00000114482
AA Change: T150I

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110126
Gene: ENSMUSG00000026981
AA Change: T150I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL1 34 175 2.88e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114485
AA Change: T134I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110129
Gene: ENSMUSG00000026981
AA Change: T134I

DomainStartEndE-ValueType
IL1 18 159 2.88e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114487
AA Change: T131I

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110131
Gene: ENSMUSG00000026981
AA Change: T131I

DomainStartEndE-ValueType
IL1 15 156 2.88e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142093
SMART Domains Protein: ENSMUSP00000141269
Gene: ENSMUSG00000026981

DomainStartEndE-ValueType
PDB:1IRP|A 8 50 1e-21 PDB
Blast:IL1 15 50 9e-20 BLAST
SCOP:d1ilr1_ 16 50 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143423
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jan 2016]
PHENOTYPE: Nullizygous mutations of this gene may result in decreased body weight, increased inflammatory response to turpentine and LPS, decreased susceptibility to bacterial infection, psoriasis, aortitis, rheumatoid arthritis, and abnormal dendritic and CD4-positive T cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih1 A C 9: 59,393,336 H542Q probably benign Het
Cnot8 T C 11: 58,113,203 S155P probably damaging Het
Dcc C T 18: 71,384,155 E810K possibly damaging Het
Dmrt2 T C 19: 25,673,480 V10A probably benign Het
Dnah17 G A 11: 118,127,283 R129W possibly damaging Het
Eif4a3 G T 11: 119,294,664 H117N probably damaging Het
Fam160b1 T A 19: 57,381,709 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm884 T C 11: 103,614,145 I2332M possibly damaging Het
Gpr179 T A 11: 97,337,845 Q1161H probably damaging Het
Grm1 T G 10: 10,746,699 M427L possibly damaging Het
Grxcr2 T A 18: 41,998,851 H51L probably damaging Het
Kcnc4 C T 3: 107,458,739 R51H probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Mcm9 G A 10: 53,538,234 P250L probably damaging Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pan3 T C 5: 147,543,210 probably null Het
Pcdhgb7 T A 18: 37,752,834 D352E probably benign Het
Pdgfa A G 5: 138,988,347 probably null Het
Pkhd1 T C 1: 20,450,304 D1938G probably damaging Het
Plac8 C T 5: 100,556,479 probably null Het
Rab11fip3 T C 17: 26,068,078 E367G possibly damaging Het
Sgo2a C T 1: 58,015,524 P289L probably benign Het
Slc22a18 T C 7: 143,499,159 Y374H probably damaging Het
Slco2a1 T C 9: 103,079,579 V530A probably benign Het
Spty2d1 A T 7: 46,998,301 S293R possibly damaging Het
Stt3b G T 9: 115,252,510 Y569* probably null Het
Tas2r140 A G 6: 133,055,580 Y72H probably benign Het
Usp35 C T 7: 97,311,639 R860H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,583 M79K probably benign Het
Vsig10l T C 7: 43,464,823 S190P probably damaging Het
Wisp1 T G 15: 66,917,282 S206A probably benign Het
Wwc2 C T 8: 47,847,555 D958N unknown Het
Zfp318 AAGAAGG A 17: 46,412,537 probably benign Het
Other mutations in Il1rn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Il1rn APN 2 24349539 missense probably damaging 1.00
IGL02606:Il1rn APN 2 24345450 intron probably benign
R1251:Il1rn UTSW 2 24345570 missense probably damaging 1.00
R1943:Il1rn UTSW 2 24348599 missense possibly damaging 0.94
R4284:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4285:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4287:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R5322:Il1rn UTSW 2 24348629 critical splice donor site probably null
R6662:Il1rn UTSW 2 24336875 start gained probably null
R7427:Il1rn UTSW 2 24349542 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAGGACTTTCTCAGCCCTC -3'
(R):5'- CTGAGGCAGAGATCTATCATCAG -3'

Sequencing Primer
(F):5'- CGGCAATTACCTGACCATTTCTTGAC -3'
(R):5'- GAGGCAGAGATCTATCATCAGAACTC -3'
Posted On2016-07-22