Mutagenetix > Incidental Mutations

Incidental Mutation 'R4418:Dgka'

326951

Institutional Source

Beutler Lab

Gene Symbol

Dgka

Ensembl Gene

ENSMUSG00000025357

Gene Name

diacylglycerol kinase, alpha

Synonyms

Dagk1

MMRRC Submission

041139-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.318) question?

Stock #

R4418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128720134-128744855 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128728094 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 462 (L462Q)

Ref Sequence

ENSEMBL: ENSMUSP00000026414 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000219834]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026414
AA Change: L462Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357
AA Change: L462Q

Domain	Start	End	E-Value	Type
Pfam:DAG_kinase_N	4	93	6.9e-31	PFAM
EFh	115	143	3.82e0	SMART
EFh	160	188	1.29e-4	SMART
C1	207	254	2.29e-10	SMART
C1	269	320	6.91e-5	SMART
DAGKc	372	495	3.11e-62	SMART
DAGKa	515	696	4.1e-103	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217957

Predicted Effect

probably benign
Transcript: ENSMUST00000219834

Meta Mutation Damage Score

0.9483

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

95% (72/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired induction of T cell anergy. T cells stimulated in anergy producing conditions show increased proliferation and interleukin 2 production. Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,261,287		probably null	Het
4930523C07Rik	A	G	1: 160,044,802		noncoding transcript	Het
5430419D17Rik	A	T	7: 131,247,465	D899V	possibly damaging	Het
Acot12	A	G	13: 91,784,405	T507A	possibly damaging	Het
Agap2	T	G	10: 127,091,650	C1113W	probably damaging	Het
Ap3s1-ps2	A	T	8: 94,405,293		noncoding transcript	Het
B3gnt3	T	C	8: 71,693,769	R39G	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Chad	C	T	11: 94,567,837	H271Y	possibly damaging	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Col6a1	T	A	10: 76,718,405	K323*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dclre1c	T	C	2: 3,452,935	F285S	possibly damaging	Het
Dctn2	T	G	10: 127,278,365	M360R	probably benign	Het
Drg2	A	C	11: 60,468,146	K364T	probably damaging	Het
Dync1li1	T	A	9: 114,706,170	S167R	probably damaging	Het
Fam189a2	T	C	19: 23,979,435	T365A	probably benign	Het
Fer	A	T	17: 64,029,291	D554V	possibly damaging	Het
Fignl2	A	G	15: 101,053,949	S151P	possibly damaging	Het
Gbgt1	A	G	2: 28,498,408	Y35C	probably damaging	Het
Gm6526	T	A	14: 43,748,845	I79K	probably damaging	Het
Gm884	T	C	11: 103,618,314		probably benign	Het
Gpr6	T	G	10: 41,070,608	N326T	probably damaging	Het
Hcn4	C	T	9: 58,843,895	T268M	probably benign	Het
Hist1h2bc	C	T	13: 23,684,503	T91M	probably damaging	Het
Hnf4g	A	G	3: 3,648,094	M243V	possibly damaging	Het
Homer1	A	G	13: 93,402,069	E314G	probably damaging	Het
Hs6st1	T	C	1: 36,104,027	Y348H	probably damaging	Het
Ifitm6	A	T	7: 141,016,071	I103N	probably damaging	Het
Ipo5	T	G	14: 120,943,893	C944G	possibly damaging	Het
Kcnb1	C	A	2: 167,105,675	E418*	probably null	Het
Kcnk2	G	A	1: 189,256,727	R207C	probably damaging	Het
Kctd8	T	C	5: 69,341,162	E47G	probably damaging	Het
Klhdc2	C	T	12: 69,307,597		probably benign	Het
Mgat1	A	G	11: 49,261,245	Y185C	probably damaging	Het
Mmp25	T	A	17: 23,644,070	R122S	probably damaging	Het
Mrpl39	C	A	16: 84,725,124		probably null	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nek1	T	C	8: 61,106,864	F1007S	probably damaging	Het
Neto1	T	C	18: 86,404,856	M146T	probably benign	Het
Opn1sw	G	A	6: 29,379,424	R45*	probably null	Het
Osbpl5	A	T	7: 143,709,815	C98*	probably null	Het
Pcdhb7	C	T	18: 37,343,482	A557V	probably benign	Het
Pecam1	A	G	11: 106,695,922	F155L	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Pmfbp1	C	A	8: 109,530,633	Q609K	probably benign	Het
Pnpo	A	T	11: 96,940,969		probably null	Het
Ppp2cb	G	A	8: 33,617,049	R254Q	probably benign	Het
Qser1	A	T	2: 104,789,421	S349T	probably damaging	Het
Rnf167	T	A	11: 70,647,917	W17R	probably damaging	Het
Rpl21-ps4	A	G	14: 11,227,879		noncoding transcript	Het
Rxfp2	A	T	5: 150,048,800	H158L	probably benign	Het
Ryr3	C	T	2: 112,831,224	C1807Y	probably damaging	Het
Scaper	T	A	9: 55,838,180	E601D	probably damaging	Het
Secisbp2l	A	T	2: 125,752,915	C542S	probably benign	Het
Slc6a19	A	G	13: 73,684,395	V393A	possibly damaging	Het
Stil	A	G	4: 115,009,377	N176S	probably benign	Het
Tap1	T	A	17: 34,188,379		probably null	Het
Tcl1b3	A	T	12: 105,193,585	Q105L	probably damaging	Het
Tmem206	T	A	1: 191,348,432	V283E	probably damaging	Het
Trappc10	G	T	10: 78,217,188	A251D	probably damaging	Het
Trim43a	G	T	9: 88,582,153	C39F	probably damaging	Het
Ttn	A	T	2: 76,889,481		probably benign	Het
Vmn2r110	A	T	17: 20,583,689	L208*	probably null	Het
Vmn2r88	G	T	14: 51,418,081	L583F	probably damaging	Het
Wasf1	C	T	10: 40,936,582	H456Y	unknown	Het
Zfp120	A	G	2: 150,118,185	I73T	possibly damaging	Het
Zfp990	T	C	4: 145,536,728	C99R	possibly damaging	Het

Other mutations in Dgka

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Dgka	APN	10	128733086	missense	probably damaging	1.00
IGL02479:Dgka	APN	10	128730246	missense	probably benign	0.01
IGL02727:Dgka	APN	10	128722448	splice site	probably benign
IGL02817:Dgka	APN	10	128730228	missense	probably benign
IGL02882:Dgka	APN	10	128733384	missense	possibly damaging	0.77
IGL03239:Dgka	APN	10	128721385	splice site	probably benign
R0321:Dgka	UTSW	10	128721083	splice site	probably benign
R0374:Dgka	UTSW	10	128721083	splice site	probably benign
R0482:Dgka	UTSW	10	128734121	nonsense	probably null
R0494:Dgka	UTSW	10	128721083	splice site	probably benign
R0573:Dgka	UTSW	10	128737007	critical splice donor site	probably null
R0594:Dgka	UTSW	10	128733110	splice site	probably benign
R0607:Dgka	UTSW	10	128720469	unclassified	probably null
R0618:Dgka	UTSW	10	128721083	splice site	probably benign
R0691:Dgka	UTSW	10	128723260	splice site	probably benign
R1378:Dgka	UTSW	10	128735827	splice site	probably null
R1424:Dgka	UTSW	10	128733333	missense	possibly damaging	0.57
R1955:Dgka	UTSW	10	128730189	critical splice donor site	probably null
R1972:Dgka	UTSW	10	128720466	missense	probably damaging	0.99
R1998:Dgka	UTSW	10	128729939	missense	probably benign	0.00
R2046:Dgka	UTSW	10	128723535	missense	probably damaging	1.00
R4206:Dgka	UTSW	10	128721195	missense	probably damaging	1.00
R4752:Dgka	UTSW	10	128736659	missense	probably benign	0.03
R5092:Dgka	UTSW	10	128735833	missense	probably damaging	0.99
R5479:Dgka	UTSW	10	128729672	critical splice acceptor site	probably null
R6009:Dgka	UTSW	10	128723679	missense	probably damaging	1.00
R6273:Dgka	UTSW	10	128723646	missense	probably benign	0.03
R6852:Dgka	UTSW	10	128722539	missense	probably damaging	1.00
R6947:Dgka	UTSW	10	128733015	missense	probably damaging	1.00
R6973:Dgka	UTSW	10	128729594	splice site	probably null
R7024:Dgka	UTSW	10	128720487	missense	probably damaging	1.00
R7076:Dgka	UTSW	10	128733583	missense	probably damaging	0.99
R7290:Dgka	UTSW	10	128733599	missense	probably damaging	0.99
R7397:Dgka	UTSW	10	128720725	missense	possibly damaging	0.95
R7823:Dgka	UTSW	10	128736266	missense	probably benign	0.00
R7856:Dgka	UTSW	10	128736664	missense	probably benign
R7939:Dgka	UTSW	10	128736664	missense	probably benign
X0020:Dgka	UTSW	10	128721317	missense	probably damaging	1.00
Z1177:Dgka	UTSW	10	128720468	missense	probably benign	0.00
Z1177:Dgka	UTSW	10	128731165	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGCTTGGACCCAGTTTTGTG -3'
(R):5'- GCTGGGTTCTAGAGACCATTGG -3'

Sequencing Primer
(F):5'- ACTGTGTACCAAGTGTCTGCAGTAC -3'
(R):5'- ACCATTGGTCAGTGCAGG -3'

Posted On

2015-07-07