Incidental Mutation 'R4475:Hspa8'
ID330521
Institutional Source Beutler Lab
Gene Symbol Hspa8
Ensembl Gene ENSMUSG00000015656
Gene Nameheat shock protein 8
SynonymsHsp73, Hsc71, Hsc70, 2410008N15Rik, Hsc73
MMRRC Submission 041732-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R4475 (G1)
Quality Score222
Status Validated
Chromosome9
Chromosomal Location40800984-40810087 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 40804146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015800] [ENSMUST00000117557] [ENSMUST00000133964]
Predicted Effect probably benign
Transcript: ENSMUST00000015800
SMART Domains Protein: ENSMUSP00000015800
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 612 2.3e-272 PFAM
Pfam:MreB_Mbl 117 383 5.3e-19 PFAM
low complexity region 613 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101927
Predicted Effect probably benign
Transcript: ENSMUST00000117557
SMART Domains Protein: ENSMUSP00000113722
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 593 3e-255 PFAM
low complexity region 594 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117870
SMART Domains Protein: ENSMUSP00000114081
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 118 2.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127699
Predicted Effect probably benign
Transcript: ENSMUST00000133964
SMART Domains Protein: ENSMUSP00000117285
Gene: ENSMUSG00000015656

DomainStartEndE-ValueType
Pfam:HSP70 6 116 2.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215526
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,040,395 T904A probably damaging Het
A630010A05Rik T A 16: 14,589,363 I52N possibly damaging Het
Adgra3 A T 5: 50,001,898 Y337N probably damaging Het
Aga T C 8: 53,511,836 L11P probably damaging Het
Akap6 T C 12: 53,141,643 F1947L probably benign Het
Atp6v1c1 T C 15: 38,677,573 I114T probably benign Het
Dbh T A 2: 27,180,972 probably null Het
Dgkh T C 14: 78,589,878 D858G possibly damaging Het
Dlx5 T C 6: 6,881,663 Y75C probably damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Epg5 A C 18: 77,948,508 D140A probably benign Het
Esr2 C T 12: 76,133,942 D402N probably benign Het
Hells A G 19: 38,945,529 T265A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ighm A G 12: 113,420,893 probably benign Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Nrxn1 G T 17: 90,701,982 N388K probably damaging Het
Olfr1412 T C 1: 92,588,579 V83A probably benign Het
Olfr418 T C 1: 173,270,913 V246A probably damaging Het
Oprk1 T A 1: 5,602,601 Y320* probably null Het
Parn A G 16: 13,664,685 S100P probably benign Het
Piezo2 A G 18: 63,102,099 L809P probably damaging Het
Plek C T 11: 16,985,528 probably null Het
Prg4 T C 1: 150,454,859 probably benign Het
Rrs1 T C 1: 9,545,585 L21P probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Smpd5 T C 15: 76,294,726 L98P probably damaging Het
Srpr A G 9: 35,212,859 K34E possibly damaging Het
Tbc1d2 A G 4: 46,609,080 V719A possibly damaging Het
Tmem52b C T 6: 129,514,256 H37Y probably benign Het
Tnip1 A G 11: 54,939,596 probably null Het
Trim3 A G 7: 105,617,802 Y457H probably damaging Het
Usp34 T C 11: 23,457,975 I2600T possibly damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Zfp365 C A 10: 67,888,920 K379N possibly damaging Het
Other mutations in Hspa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03388:Hspa8 APN 9 40804928 unclassified probably benign
R0006:Hspa8 UTSW 9 40804629 missense probably benign 0.05
R0799:Hspa8 UTSW 9 40803841 missense probably damaging 1.00
R0866:Hspa8 UTSW 9 40802624 critical splice donor site probably null
R3621:Hspa8 UTSW 9 40801923 start codon destroyed probably damaging 0.96
R5096:Hspa8 UTSW 9 40802901 unclassified probably benign
R6116:Hspa8 UTSW 9 40804975 missense probably damaging 0.98
R6363:Hspa8 UTSW 9 40803065 missense probably damaging 1.00
R7067:Hspa8 UTSW 9 40804625 missense probably damaging 0.97
R7310:Hspa8 UTSW 9 40803408 missense probably benign 0.09
R7549:Hspa8 UTSW 9 40802959 splice site probably null
R7998:Hspa8 UTSW 9 40804514 missense probably damaging 1.00
Z1177:Hspa8 UTSW 9 40802802 missense probably damaging 0.98
Z1177:Hspa8 UTSW 9 40802805 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAGCTTGTATAGAAAGCCCAGG -3'
(R):5'- ACCCTTGTCATTGGTGATGG -3'

Sequencing Primer
(F):5'- TATAGAAAGCCCAGGGAAGTTCCTC -3'
(R):5'- CTGTGCTCTTATCTACAGCAGAAAC -3'
Posted On2015-07-21