Incidental Mutation 'R4475:Nedd4'
ID330522
Institutional Source Beutler Lab
Gene Symbol Nedd4
Ensembl Gene ENSMUSG00000032216
Gene Nameneural precursor cell expressed, developmentally down-regulated 4
SynonymsNedd4, Nedd4-1, Nedd4a
MMRRC Submission 041732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4475 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72662346-72749852 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 72671239 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 78 (R78*)
Ref Sequence ENSEMBL: ENSMUSP00000138983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034740] [ENSMUST00000183375] [ENSMUST00000184333] [ENSMUST00000184450]
Predicted Effect probably null
Transcript: ENSMUST00000034740
AA Change: R78*
SMART Domains Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: R78*

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
low complexity region 283 293 N/A INTRINSIC
WW 406 438 1.31e-12 SMART
WW 461 493 1.26e-14 SMART
HECTc 550 886 2.37e-194 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183375
AA Change: R78*
SMART Domains Protein: ENSMUSP00000138852
Gene: ENSMUSG00000032216
AA Change: R78*

DomainStartEndE-ValueType
C2 79 163 1.12e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184180
Predicted Effect probably benign
Transcript: ENSMUST00000184333
SMART Domains Protein: ENSMUSP00000139190
Gene: ENSMUSG00000032216

DomainStartEndE-ValueType
C2 4 71 3.38e-4 SMART
WW 140 172 2.32e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184450
AA Change: R78*
SMART Domains Protein: ENSMUSP00000138983
Gene: ENSMUSG00000032216
AA Change: R78*

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184737
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,040,395 T904A probably damaging Het
A630010A05Rik T A 16: 14,589,363 I52N possibly damaging Het
Adgra3 A T 5: 50,001,898 Y337N probably damaging Het
Aga T C 8: 53,511,836 L11P probably damaging Het
Akap6 T C 12: 53,141,643 F1947L probably benign Het
Atp6v1c1 T C 15: 38,677,573 I114T probably benign Het
Dbh T A 2: 27,180,972 probably null Het
Dgkh T C 14: 78,589,878 D858G possibly damaging Het
Dlx5 T C 6: 6,881,663 Y75C probably damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Epg5 A C 18: 77,948,508 D140A probably benign Het
Esr2 C T 12: 76,133,942 D402N probably benign Het
Hells A G 19: 38,945,529 T265A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspa8 T A 9: 40,804,146 probably benign Het
Ighm A G 12: 113,420,893 probably benign Het
Nrxn1 G T 17: 90,701,982 N388K probably damaging Het
Olfr1412 T C 1: 92,588,579 V83A probably benign Het
Olfr418 T C 1: 173,270,913 V246A probably damaging Het
Oprk1 T A 1: 5,602,601 Y320* probably null Het
Parn A G 16: 13,664,685 S100P probably benign Het
Piezo2 A G 18: 63,102,099 L809P probably damaging Het
Plek C T 11: 16,985,528 probably null Het
Prg4 T C 1: 150,454,859 probably benign Het
Rrs1 T C 1: 9,545,585 L21P probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Smpd5 T C 15: 76,294,726 L98P probably damaging Het
Srpr A G 9: 35,212,859 K34E possibly damaging Het
Tbc1d2 A G 4: 46,609,080 V719A possibly damaging Het
Tmem52b C T 6: 129,514,256 H37Y probably benign Het
Tnip1 A G 11: 54,939,596 probably null Het
Trim3 A G 7: 105,617,802 Y457H probably damaging Het
Usp34 T C 11: 23,457,975 I2600T possibly damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Zfp365 C A 10: 67,888,920 K379N possibly damaging Het
Other mutations in Nedd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nedd4 APN 9 72735089 missense probably damaging 1.00
IGL00573:Nedd4 APN 9 72686056 splice site probably null
IGL01973:Nedd4 APN 9 72736934 missense possibly damaging 0.81
IGL02177:Nedd4 APN 9 72747157 missense probably damaging 1.00
IGL03082:Nedd4 APN 9 72677394 critical splice donor site probably null
Evaporation UTSW 9 72686095 missense probably damaging 1.00
reduction UTSW 9 72731271 missense possibly damaging 0.49
R0194:Nedd4 UTSW 9 72670053 missense possibly damaging 0.72
R0714:Nedd4 UTSW 9 72731446 splice site probably benign
R1331:Nedd4 UTSW 9 72677386 missense probably damaging 1.00
R1633:Nedd4 UTSW 9 72671257 missense possibly damaging 0.50
R1764:Nedd4 UTSW 9 72730907 missense probably damaging 0.99
R2192:Nedd4 UTSW 9 72742718 missense probably damaging 0.99
R2196:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2220:Nedd4 UTSW 9 72736707 missense probably damaging 1.00
R2850:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2994:Nedd4 UTSW 9 72730903 missense probably benign 0.04
R3040:Nedd4 UTSW 9 72669961 missense probably benign
R3697:Nedd4 UTSW 9 72740187 missense probably damaging 1.00
R3884:Nedd4 UTSW 9 72725077 missense probably benign 0.16
R4476:Nedd4 UTSW 9 72671239 nonsense probably null
R4883:Nedd4 UTSW 9 72740233 splice site probably null
R5066:Nedd4 UTSW 9 72710519 missense probably damaging 1.00
R5947:Nedd4 UTSW 9 72730850 intron probably benign
R5974:Nedd4 UTSW 9 72743638 critical splice donor site probably null
R6247:Nedd4 UTSW 9 72726438 missense probably damaging 1.00
R6651:Nedd4 UTSW 9 72731271 missense possibly damaging 0.49
R6661:Nedd4 UTSW 9 72686095 missense probably damaging 1.00
R7170:Nedd4 UTSW 9 72670099 missense probably benign 0.00
R7237:Nedd4 UTSW 9 72725064 missense probably benign 0.04
R7653:Nedd4 UTSW 9 72743628 missense probably damaging 1.00
R7772:Nedd4 UTSW 9 72677326 missense possibly damaging 0.77
R7905:Nedd4 UTSW 9 72677379 nonsense probably null
R7988:Nedd4 UTSW 9 72677379 nonsense probably null
Z1088:Nedd4 UTSW 9 72670078 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CACAGCAACAGTGGTAACTTCC -3'
(R):5'- GGATCTCACTGTGTACCAAAATTTG -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- ACCAAAATTTGCTACTATCACTCAG -3'
Posted On2015-07-21