Incidental Mutation 'R4475:Parn'
ID330533
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Namepoly(A)-specific ribonuclease (deadenylation nuclease)
SynonymsDAN, 1200003I18Rik
MMRRC Submission 041732-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4475 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13537960-13668170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13664685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 100 (S100P)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000229042] [ENSMUST00000231003]
Predicted Effect probably benign
Transcript: ENSMUST00000058884
AA Change: S100P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: S100P

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229526
Predicted Effect probably benign
Transcript: ENSMUST00000231003
AA Change: S100P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,040,395 T904A probably damaging Het
A630010A05Rik T A 16: 14,589,363 I52N possibly damaging Het
Adgra3 A T 5: 50,001,898 Y337N probably damaging Het
Aga T C 8: 53,511,836 L11P probably damaging Het
Akap6 T C 12: 53,141,643 F1947L probably benign Het
Atp6v1c1 T C 15: 38,677,573 I114T probably benign Het
Dbh T A 2: 27,180,972 probably null Het
Dgkh T C 14: 78,589,878 D858G possibly damaging Het
Dlx5 T C 6: 6,881,663 Y75C probably damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Epg5 A C 18: 77,948,508 D140A probably benign Het
Esr2 C T 12: 76,133,942 D402N probably benign Het
Hells A G 19: 38,945,529 T265A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspa8 T A 9: 40,804,146 probably benign Het
Ighm A G 12: 113,420,893 probably benign Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Nrxn1 G T 17: 90,701,982 N388K probably damaging Het
Olfr1412 T C 1: 92,588,579 V83A probably benign Het
Olfr418 T C 1: 173,270,913 V246A probably damaging Het
Oprk1 T A 1: 5,602,601 Y320* probably null Het
Piezo2 A G 18: 63,102,099 L809P probably damaging Het
Plek C T 11: 16,985,528 probably null Het
Prg4 T C 1: 150,454,859 probably benign Het
Rrs1 T C 1: 9,545,585 L21P probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Smpd5 T C 15: 76,294,726 L98P probably damaging Het
Srpr A G 9: 35,212,859 K34E possibly damaging Het
Tbc1d2 A G 4: 46,609,080 V719A possibly damaging Het
Tmem52b C T 6: 129,514,256 H37Y probably benign Het
Tnip1 A G 11: 54,939,596 probably null Het
Trim3 A G 7: 105,617,802 Y457H probably damaging Het
Usp34 T C 11: 23,457,975 I2600T possibly damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Zfp365 C A 10: 67,888,920 K379N possibly damaging Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4474:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R4795:Parn UTSW 16 13606202 missense probably benign 0.06
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5226:Parn UTSW 16 13625552 missense probably benign
R5355:Parn UTSW 16 13668022 missense possibly damaging 0.92
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R5979:Parn UTSW 16 13606171 missense probably damaging 1.00
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 intron probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAGATAATTTACCCAAAGCC -3'
(R):5'- AAACCTGGCTCTCCTGTGTC -3'

Sequencing Primer
(F):5'- GGGCATCATATAGTCCAGACTGC -3'
(R):5'- AGCATTCCATGGACTTTTTGCTG -3'
Posted On2015-07-21