Incidental Mutation 'R4508:Tmem38a'
ID331075
Institutional Source Beutler Lab
Gene Symbol Tmem38a
Ensembl Gene ENSMUSG00000031791
Gene Nametransmembrane protein 38A
Synonyms1110001E17Rik, TRIC-A
MMRRC Submission 041757-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4508 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72572055-72587282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72572161 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 20 (P20S)
Ref Sequence ENSEMBL: ENSMUSP00000148844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034244] [ENSMUST00000058733] [ENSMUST00000167290] [ENSMUST00000211914] [ENSMUST00000212763]
Predicted Effect probably benign
Transcript: ENSMUST00000034244
AA Change: P20S

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034244
Gene: ENSMUSG00000031791
AA Change: P20S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:TRIC 40 231 5.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058733
SMART Domains Protein: ENSMUSP00000059943
Gene: ENSMUSG00000044600

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163745
Predicted Effect probably benign
Transcript: ENSMUST00000167290
SMART Domains Protein: ENSMUSP00000127441
Gene: ENSMUSG00000044600

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000211914
AA Change: P20S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212763
AA Change: P20S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A G 2: 150,904,355 probably benign Het
Amer3 A G 1: 34,588,299 R540G probably benign Het
Ank C T 15: 27,564,977 R255W probably damaging Het
Ank3 A C 10: 69,892,370 I629L probably damaging Het
Arhgap11a T A 2: 113,842,042 N194Y probably damaging Het
BB014433 T C 8: 15,042,095 T253A possibly damaging Het
Ccdc40 C A 11: 119,242,509 D534E probably damaging Het
Chrna2 C A 14: 66,146,453 N106K probably damaging Het
Clec2f C A 6: 129,020,511 noncoding transcript Het
Cnnm2 G A 19: 46,877,270 D766N probably benign Het
Ctc1 A G 11: 69,016,117 probably null Het
Ddc C T 11: 11,819,393 probably null Het
Doc2g G A 19: 4,004,036 probably benign Het
Ep400 T C 5: 110,703,615 T1334A unknown Het
Epdr1 T C 13: 19,594,489 I44V probably benign Het
Fam71f1 T C 6: 29,323,765 V163A probably benign Het
Fbp2 A T 13: 62,841,865 I209N probably damaging Het
Gldc G T 19: 30,143,407 Q375K probably damaging Het
Hc A C 2: 35,013,065 V1058G possibly damaging Het
Hydin T A 8: 110,519,254 S2200T possibly damaging Het
Kcnc1 C T 7: 46,428,288 P505S probably benign Het
Kifc3 T C 8: 95,107,420 probably null Het
Klhl10 A G 11: 100,442,176 E49G possibly damaging Het
Lhx5 T C 5: 120,435,434 S161P probably damaging Het
Lilra6 G T 7: 3,912,029 Y455* probably null Het
Lzts1 C T 8: 69,135,618 R562H probably benign Het
Muc6 G A 7: 141,640,089 probably benign Het
Ogfod2 C T 5: 124,113,254 Q74* probably null Het
Olfr1305 A C 2: 111,873,602 D84E probably damaging Het
Olfr183 T A 16: 58,999,775 V30E probably benign Het
Polr2a T C 11: 69,742,559 probably null Het
Ptpre T C 7: 135,669,103 L329P probably damaging Het
Rnh1 T C 7: 141,164,543 Q73R possibly damaging Het
Scly G A 1: 91,308,325 V100I possibly damaging Het
Sos2 A T 12: 69,635,661 L261* probably null Het
Sp1 A C 15: 102,409,312 Q422P possibly damaging Het
Sp3 A T 2: 72,970,397 F468Y probably damaging Het
Tenm2 T C 11: 36,008,345 Y2662C possibly damaging Het
Tmprss2 C A 16: 97,570,427 G281C probably damaging Het
Tmprss6 A T 15: 78,459,778 Y183N probably damaging Het
Ttn A T 2: 76,750,340 L23403Q probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn1r90 T C 7: 14,562,159 N5D probably benign Het
Vps13b A G 15: 35,709,673 D1922G possibly damaging Het
Wrb T A 16: 96,145,699 probably benign Het
Other mutations in Tmem38a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Tmem38a APN 8 72579974 missense probably damaging 0.99
IGL02715:Tmem38a APN 8 72579668 missense possibly damaging 0.69
IGL02967:Tmem38a APN 8 72586082 missense possibly damaging 0.95
R0631:Tmem38a UTSW 8 72580018 missense probably benign 0.05
R1073:Tmem38a UTSW 8 72580103 missense probably damaging 1.00
R1161:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1310:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1489:Tmem38a UTSW 8 72579635 missense probably damaging 1.00
R2040:Tmem38a UTSW 8 72581252 missense probably damaging 1.00
R4515:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4517:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4521:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4522:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4529:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4867:Tmem38a UTSW 8 72581233 missense possibly damaging 0.80
R5200:Tmem38a UTSW 8 72580034 missense probably damaging 1.00
R5807:Tmem38a UTSW 8 72580100 missense probably damaging 1.00
R5882:Tmem38a UTSW 8 72585887 missense probably damaging 1.00
R7803:Tmem38a UTSW 8 72572120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACGAGTTCTGACGTCCC -3'
(R):5'- AACAAGAGCGCTCCTTTTCTTC -3'

Sequencing Primer
(F):5'- TACGGCCCCGCATTTTGG -3'
(R):5'- GAGCACTCCACGATCTCAG -3'
Posted On2015-07-21