Incidental Mutation 'R1310:Tmem38a'
ID157907
Institutional Source Beutler Lab
Gene Symbol Tmem38a
Ensembl Gene ENSMUSG00000031791
Gene Nametransmembrane protein 38A
Synonyms1110001E17Rik, TRIC-A
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1310 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72572055-72587282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72579970 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 98 (F98I)
Ref Sequence ENSEMBL: ENSMUSP00000034244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034244] [ENSMUST00000211914] [ENSMUST00000212763]
Predicted Effect probably damaging
Transcript: ENSMUST00000034244
AA Change: F98I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034244
Gene: ENSMUSG00000031791
AA Change: F98I

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:TRIC 40 231 5.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211914
Predicted Effect probably damaging
Transcript: ENSMUST00000212763
AA Change: F98I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Tmem38a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Tmem38a APN 8 72579974 missense probably damaging 0.99
IGL02715:Tmem38a APN 8 72579668 missense possibly damaging 0.69
IGL02967:Tmem38a APN 8 72586082 missense possibly damaging 0.95
R0631:Tmem38a UTSW 8 72580018 missense probably benign 0.05
R1073:Tmem38a UTSW 8 72580103 missense probably damaging 1.00
R1161:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1489:Tmem38a UTSW 8 72579635 missense probably damaging 1.00
R2040:Tmem38a UTSW 8 72581252 missense probably damaging 1.00
R4508:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4515:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4517:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4521:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4522:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4529:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4867:Tmem38a UTSW 8 72581233 missense possibly damaging 0.80
R5200:Tmem38a UTSW 8 72580034 missense probably damaging 1.00
R5807:Tmem38a UTSW 8 72580100 missense probably damaging 1.00
R5882:Tmem38a UTSW 8 72585887 missense probably damaging 1.00
R7803:Tmem38a UTSW 8 72572120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAGCCCATCATTGACTACTTCAGC -3'
(R):5'- ACTGAATACCTTGTGGGAGTGAATGC -3'

Sequencing Primer
(F):5'- TTGACTACTTCAGCAACAGCTC -3'
(R):5'- ctgcaagctcctgagcc -3'
Posted On2014-02-18