Incidental Mutation 'R4486:Bbx'
ID331635
Institutional Source Beutler Lab
Gene Symbol Bbx
Ensembl Gene ENSMUSG00000022641
Gene Namebobby sox HMG box containing
Synonyms5730403O13Rik, 5530401J07Rik
MMRRC Submission 041742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4486 (G1)
Quality Score188
Status Validated
Chromosome16
Chromosomal Location50191844-50432390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50200414 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 799 (V799A)
Ref Sequence ENSEMBL: ENSMUSP00000066384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066037] [ENSMUST00000089404] [ENSMUST00000114488] [ENSMUST00000138166]
PDB Structure
Solution Structure of the HMG_box Domain of Murine Bobby Sox Homolog [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000066037
AA Change: V799A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066384
Gene: ENSMUSG00000022641
AA Change: V799A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
Pfam:DUF2028 109 150 3.1e-22 PFAM
Pfam:DUF2028 140 214 4.4e-26 PFAM
low complexity region 216 230 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 561 566 N/A INTRINSIC
low complexity region 780 795 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089404
AA Change: V857A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086826
Gene: ENSMUSG00000022641
AA Change: V857A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.7e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114488
AA Change: V877A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110132
Gene: ENSMUSG00000022641
AA Change: V877A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138166
AA Change: V877A

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119238
Gene: ENSMUSG00000022641
AA Change: V877A

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 335 9.2e-54 PFAM
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show increased IgA level, abnormal tooth morphology, and a reduction in heart weight, lean body mass, body length, long bone length, bone mineral density, and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adam22 A T 5: 8,180,227 probably benign Het
Adamts18 G T 8: 113,713,193 P923T probably benign Het
AI314180 A G 4: 58,820,086 probably benign Het
Ank3 C T 10: 70,001,974 T1604I possibly damaging Het
Armc10 A G 5: 21,653,434 Q159R probably damaging Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
B4galt3 A G 1: 171,271,773 T36A possibly damaging Het
Bud23 T C 5: 135,063,925 probably null Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp4f39 T A 17: 32,483,454 D308E probably damaging Het
Dnah6 A G 6: 73,038,746 V3584A probably damaging Het
Frk T C 10: 34,608,381 I450T probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hyi G A 4: 118,362,477 G237D probably damaging Het
Jrkl T C 9: 13,245,371 N95S probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Nanog T C 6: 122,712,717 probably null Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Olfr813 T C 10: 129,856,698 F60S probably damaging Het
Pcdha3 T C 18: 36,947,351 V382A probably damaging Het
Pla2g4c T A 7: 13,337,751 N165K probably benign Het
Rexo5 T C 7: 119,825,577 I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rpusd2 T C 2: 119,035,224 V134A probably damaging Het
Serpina1c T A 12: 103,897,000 probably null Het
Slc6a19 A T 13: 73,681,717 I606N probably damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Tas2r143 A G 6: 42,400,694 M153V probably benign Het
Thrb G T 14: 17,925,640 M1I probably null Het
Trbc2 A G 6: 41,546,880 probably benign Het
Trim37 T A 11: 87,196,825 S587R probably benign Het
Ulbp1 T A 10: 7,447,397 H151L probably benign Het
Vmn2r54 A T 7: 12,632,272 L245* probably null Het
Vmn2r78 A C 7: 86,920,751 probably null Het
Xlr5b T C X: 73,157,898 probably null Het
Xrcc4 A C 13: 89,992,588 S167R possibly damaging Het
Zfp994 C T 17: 22,201,560 C136Y probably damaging Het
Other mutations in Bbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Bbx APN 16 50202513 missense probably benign 0.08
IGL01544:Bbx APN 16 50274777 nonsense probably null
IGL02073:Bbx APN 16 50202491 missense probably damaging 1.00
IGL02302:Bbx APN 16 50224915 missense probably damaging 1.00
IGL02566:Bbx APN 16 50223240 splice site probably benign
IGL02618:Bbx APN 16 50247798 missense probably damaging 1.00
IGL03187:Bbx APN 16 50274563 missense probably damaging 0.96
IGL03215:Bbx APN 16 50202572 missense probably damaging 1.00
IGL03295:Bbx APN 16 50224564 missense probably damaging 1.00
dalton UTSW 16 50210442 splice site probably null
PIT4378001:Bbx UTSW 16 50280473 nonsense probably null
R0024:Bbx UTSW 16 50224918 missense probably benign
R0024:Bbx UTSW 16 50224918 missense probably benign
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0143:Bbx UTSW 16 50280392 missense probably benign 0.32
R0144:Bbx UTSW 16 50280392 missense probably benign 0.32
R0374:Bbx UTSW 16 50280392 missense probably benign 0.32
R0532:Bbx UTSW 16 50266284 missense probably damaging 1.00
R0550:Bbx UTSW 16 50274533 splice site probably benign
R0762:Bbx UTSW 16 50225166 missense possibly damaging 0.94
R0881:Bbx UTSW 16 50220600 splice site probably benign
R1448:Bbx UTSW 16 50266270 nonsense probably null
R1916:Bbx UTSW 16 50266245 missense probably damaging 1.00
R1983:Bbx UTSW 16 50209117 missense possibly damaging 0.62
R2006:Bbx UTSW 16 50224395 missense possibly damaging 0.93
R2095:Bbx UTSW 16 50224689 missense possibly damaging 0.88
R2145:Bbx UTSW 16 50274544 splice site probably benign
R2475:Bbx UTSW 16 50220519 missense probably damaging 0.99
R2892:Bbx UTSW 16 50224741 missense probably damaging 1.00
R4130:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4177:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4989:Bbx UTSW 16 50224738 missense probably damaging 1.00
R5005:Bbx UTSW 16 50266351 missense probably damaging 1.00
R5427:Bbx UTSW 16 50280497 missense probably benign
R5582:Bbx UTSW 16 50223356 missense probably damaging 1.00
R6063:Bbx UTSW 16 50251367 missense probably benign
R6216:Bbx UTSW 16 50251388 missense probably benign 0.00
R6246:Bbx UTSW 16 50224660 missense probably benign 0.04
R6618:Bbx UTSW 16 50266263 missense probably damaging 1.00
R6782:Bbx UTSW 16 50200565 missense probably benign 0.00
R7007:Bbx UTSW 16 50202488 missense possibly damaging 0.67
R7130:Bbx UTSW 16 50210442 splice site probably null
R7864:Bbx UTSW 16 50262434 missense probably damaging 0.99
R7947:Bbx UTSW 16 50262434 missense probably damaging 0.99
X0021:Bbx UTSW 16 50247805 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACGTAGTTGCCATGTTCACTAATG -3'
(R):5'- TCCCAGGATCCTTCTCTGAAG -3'

Sequencing Primer
(F):5'- AATGTTCCCTGCACTGTTAATTCAC -3'
(R):5'- AGCCTCCTGTGATGGATTTC -3'
Posted On2015-07-21