Incidental Mutation 'R4486:Tas2r143'
ID331609
Institutional Source Beutler Lab
Gene Symbol Tas2r143
Ensembl Gene ENSMUSG00000046652
Gene Nametaste receptor, type 2, member 143
Synonymsmt2r36, Tas2r43
MMRRC Submission 041742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4486 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42400238-42401119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42400694 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 153 (M153V)
Ref Sequence ENSEMBL: ENSMUSP00000057910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000057398
AA Change: M153V

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652
AA Change: M153V

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070178
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Adam22 A T 5: 8,180,227 probably benign Het
Adamts18 G T 8: 113,713,193 P923T probably benign Het
AI314180 A G 4: 58,820,086 probably benign Het
Ank3 C T 10: 70,001,974 T1604I possibly damaging Het
Armc10 A G 5: 21,653,434 Q159R probably damaging Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
B4galt3 A G 1: 171,271,773 T36A possibly damaging Het
Bbx A G 16: 50,200,414 V799A probably damaging Het
Bud23 T C 5: 135,063,925 probably null Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp4f39 T A 17: 32,483,454 D308E probably damaging Het
Dnah6 A G 6: 73,038,746 V3584A probably damaging Het
Frk T C 10: 34,608,381 I450T probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hyi G A 4: 118,362,477 G237D probably damaging Het
Jrkl T C 9: 13,245,371 N95S probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Nanog T C 6: 122,712,717 probably null Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Olfr813 T C 10: 129,856,698 F60S probably damaging Het
Pcdha3 T C 18: 36,947,351 V382A probably damaging Het
Pla2g4c T A 7: 13,337,751 N165K probably benign Het
Rexo5 T C 7: 119,825,577 I362T probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rpusd2 T C 2: 119,035,224 V134A probably damaging Het
Serpina1c T A 12: 103,897,000 probably null Het
Slc6a19 A T 13: 73,681,717 I606N probably damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Thrb G T 14: 17,925,640 M1I probably null Het
Trbc2 A G 6: 41,546,880 probably benign Het
Trim37 T A 11: 87,196,825 S587R probably benign Het
Ulbp1 T A 10: 7,447,397 H151L probably benign Het
Vmn2r54 A T 7: 12,632,272 L245* probably null Het
Vmn2r78 A C 7: 86,920,751 probably null Het
Xlr5b T C X: 73,157,898 probably null Het
Xrcc4 A C 13: 89,992,588 S167R possibly damaging Het
Zfp994 C T 17: 22,201,560 C136Y probably damaging Het
Other mutations in Tas2r143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Tas2r143 APN 6 42400334 nonsense probably null
IGL02832:Tas2r143 APN 6 42400325 missense possibly damaging 0.55
R0125:Tas2r143 UTSW 6 42400955 missense probably benign 0.01
R1035:Tas2r143 UTSW 6 42400265 missense probably benign 0.16
R1073:Tas2r143 UTSW 6 42400760 missense probably benign 0.01
R1400:Tas2r143 UTSW 6 42400383 missense probably benign 0.35
R1774:Tas2r143 UTSW 6 42400371 missense probably damaging 1.00
R2391:Tas2r143 UTSW 6 42400876 missense probably damaging 0.99
R3617:Tas2r143 UTSW 6 42401063 missense probably benign 0.20
R3693:Tas2r143 UTSW 6 42400976 missense probably benign 0.00
R4283:Tas2r143 UTSW 6 42401073 unclassified probably null
R5005:Tas2r143 UTSW 6 42400724 missense probably benign 0.02
R6360:Tas2r143 UTSW 6 42400835 missense probably benign 0.40
R7163:Tas2r143 UTSW 6 42400268 missense probably benign
R7827:Tas2r143 UTSW 6 42400722 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTATTGGCATCCTCTGGG -3'
(R):5'- GTGCCTGAGTATGGAGATCC -3'

Sequencing Primer
(F):5'- TCCTCTGGGATTTCACTAACAC -3'
(R):5'- TGGAGATCCCAAGGCCCAG -3'
Posted On2015-07-21