Incidental Mutation 'R4498:Rin3'
ID331710
Institutional Source Beutler Lab
Gene Symbol Rin3
Ensembl Gene ENSMUSG00000044456
Gene NameRas and Rab interactor 3
Synonyms
MMRRC Submission 041751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4498 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102283048-102390855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102369680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 537 (V537M)
Ref Sequence ENSEMBL: ENSMUSP00000122646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056950] [ENSMUST00000133820]
Predicted Effect probably damaging
Transcript: ENSMUST00000056950
AA Change: V617M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060771
Gene: ENSMUSG00000044456
AA Change: V617M

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
SH2 61 149 1.89e-2 SMART
low complexity region 254 311 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 579 594 N/A INTRINSIC
low complexity region 714 728 N/A INTRINSIC
VPS9 736 852 5.75e-38 SMART
RA 873 960 3.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131076
Predicted Effect probably damaging
Transcript: ENSMUST00000133820
AA Change: V537M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122646
Gene: ENSMUSG00000044456
AA Change: V537M

DomainStartEndE-ValueType
Blast:SH2 1 69 3e-39 BLAST
SCOP:d1a81a2 3 77 2e-4 SMART
low complexity region 174 231 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 368 389 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
low complexity region 634 648 N/A INTRINSIC
VPS9 656 772 5.75e-38 SMART
RA 793 880 3.5e-4 SMART
Meta Mutation Damage Score 0.2611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 91% (53/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary: This protein encoded by this gene is a member of the RIN family of Ras interaction-interference proteins, which are binding partners to the RAB5 small GTPases. The protein functions as a guanine nucleotide exchange for RAB5B and RAB31. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Acot9 T A X: 155,264,068 L18* probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
C87499 A T 4: 88,628,892 probably null Het
Ccdc17 G T 4: 116,597,241 probably benign Het
Ctnnd2 A C 15: 30,619,874 D124A probably damaging Het
Cux1 T C 5: 136,312,993 N424S probably damaging Het
Dhrs7c T C 11: 67,815,880 F214S possibly damaging Het
Fat2 T C 11: 55,270,097 D3269G possibly damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Glul G T 1: 153,907,103 G187* probably null Het
Gnmt ATTAGGGGATGGTCTTAGGG ATTAGGG 17: 46,725,736 probably benign Het
H2-Q7 A T 17: 35,439,530 Y48F probably damaging Het
Hes3 T C 4: 152,287,085 T136A probably benign Het
Krt40 T C 11: 99,543,074 T29A possibly damaging Het
Lrrc37a C A 11: 103,501,798 D934Y probably benign Het
Mctp2 T A 7: 72,183,851 D581V probably damaging Het
Med27 T C 2: 29,471,342 S38P probably damaging Het
Mff A G 1: 82,741,780 probably benign Het
Mmadhc T C 2: 50,280,224 K292R probably benign Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Mthfd1 G T 12: 76,314,990 L123F probably damaging Het
Mug2 T A 6: 122,082,752 L1363Q probably damaging Het
Myh4 T C 11: 67,251,752 I913T probably damaging Het
Myo16 T A 8: 10,435,869 N649K probably benign Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nup155 A G 15: 8,153,673 D1239G possibly damaging Het
Olfr1444 T C 19: 12,862,669 V298A probably damaging Het
Olfr866 G C 9: 20,027,733 N68K possibly damaging Het
Phf10 T A 17: 14,945,115 N493I probably benign Het
Prr12 T C 7: 45,045,914 E1376G unknown Het
Rasa3 T C 8: 13,614,587 H75R probably benign Het
Samd4 C T 14: 47,096,109 T272I probably damaging Het
Sept5 C T 16: 18,623,392 G257D probably damaging Het
Serpina6 T C 12: 103,654,067 K141R probably benign Het
Siglecf T A 7: 43,352,276 I170N possibly damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Stk40 G A 4: 126,129,751 probably null Het
Syne1 A G 10: 5,031,768 S8700P probably benign Het
Tbc1d4 C T 14: 101,608,336 G42E probably damaging Het
Tfap2c C T 2: 172,557,182 Q425* probably null Het
Tmem255b T C 8: 13,455,998 S202P probably damaging Het
Traf6 T C 2: 101,684,546 S16P probably benign Het
Ttc12 A G 9: 49,472,405 I66T probably damaging Het
Ttc21a G A 9: 119,958,819 D818N possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Zgrf1 C A 3: 127,586,100 S211* probably null Het
Other mutations in Rin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Rin3 APN 12 102373603 missense probably damaging 1.00
IGL01521:Rin3 APN 12 102369048 missense probably benign 0.00
PIT4495001:Rin3 UTSW 12 102369036 missense probably benign 0.02
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0109:Rin3 UTSW 12 102313081 missense possibly damaging 0.74
R0504:Rin3 UTSW 12 102387564 nonsense probably null
R0699:Rin3 UTSW 12 102369575 missense probably damaging 0.98
R1499:Rin3 UTSW 12 102368759 missense unknown
R1733:Rin3 UTSW 12 102369330 nonsense probably null
R1743:Rin3 UTSW 12 102390096 missense possibly damaging 0.87
R2911:Rin3 UTSW 12 102373584 missense probably benign 0.43
R2961:Rin3 UTSW 12 102313046 nonsense probably null
R3153:Rin3 UTSW 12 102368541 missense unknown
R3932:Rin3 UTSW 12 102390083 missense probably damaging 0.98
R4803:Rin3 UTSW 12 102361383 intron probably benign
R4985:Rin3 UTSW 12 102368562 missense unknown
R5300:Rin3 UTSW 12 102369670 missense probably benign 0.29
R5363:Rin3 UTSW 12 102325834 missense probably damaging 0.97
R5414:Rin3 UTSW 12 102389857 nonsense probably null
R5458:Rin3 UTSW 12 102373716 missense probably damaging 0.99
R5503:Rin3 UTSW 12 102313055 missense probably benign 0.17
R5534:Rin3 UTSW 12 102387632 missense probably damaging 1.00
R5599:Rin3 UTSW 12 102389929 missense probably damaging 1.00
R5752:Rin3 UTSW 12 102313119 start gained probably benign
R5874:Rin3 UTSW 12 102389843 missense probably damaging 1.00
R6467:Rin3 UTSW 12 102369325 missense probably benign 0.06
R7250:Rin3 UTSW 12 102368634 missense unknown
R7264:Rin3 UTSW 12 102390115 missense probably benign 0.01
R7514:Rin3 UTSW 12 102369650 nonsense probably null
R7534:Rin3 UTSW 12 102350941 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCAACCAGCAGTGCAGAG -3'
(R):5'- GCGCCTGAGTGTATTTATGC -3'

Sequencing Primer
(F):5'- CAGAGGAGGAGCTGGAGTTC -3'
(R):5'- GCCTGAGTGTATTTATGCACCGC -3'
Posted On2015-07-21