Incidental Mutation 'R4498:Rasa3'
ID331700
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene NameRAS p21 protein activator 3
SynonymsGAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat
MMRRC Submission 041751-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4498 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13566948-13677603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13614587 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 75 (H75R)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551] [ENSMUST00000154454]
Predicted Effect probably benign
Transcript: ENSMUST00000117551
AA Change: H75R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: H75R

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132439
Predicted Effect probably benign
Transcript: ENSMUST00000154454
Meta Mutation Damage Score 0.2738 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 91% (53/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Acot9 T A X: 155,264,068 L18* probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
C87499 A T 4: 88,628,892 probably null Het
Ccdc17 G T 4: 116,597,241 probably benign Het
Ctnnd2 A C 15: 30,619,874 D124A probably damaging Het
Cux1 T C 5: 136,312,993 N424S probably damaging Het
Dhrs7c T C 11: 67,815,880 F214S possibly damaging Het
Fat2 T C 11: 55,270,097 D3269G possibly damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Glul G T 1: 153,907,103 G187* probably null Het
Gnmt ATTAGGGGATGGTCTTAGGG ATTAGGG 17: 46,725,736 probably benign Het
H2-Q7 A T 17: 35,439,530 Y48F probably damaging Het
Hes3 T C 4: 152,287,085 T136A probably benign Het
Krt40 T C 11: 99,543,074 T29A possibly damaging Het
Lrrc37a C A 11: 103,501,798 D934Y probably benign Het
Mctp2 T A 7: 72,183,851 D581V probably damaging Het
Med27 T C 2: 29,471,342 S38P probably damaging Het
Mff A G 1: 82,741,780 probably benign Het
Mmadhc T C 2: 50,280,224 K292R probably benign Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Mthfd1 G T 12: 76,314,990 L123F probably damaging Het
Mug2 T A 6: 122,082,752 L1363Q probably damaging Het
Myh4 T C 11: 67,251,752 I913T probably damaging Het
Myo16 T A 8: 10,435,869 N649K probably benign Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Ndst4 A G 3: 125,438,358 D192G probably damaging Het
Nup155 A G 15: 8,153,673 D1239G possibly damaging Het
Olfr1444 T C 19: 12,862,669 V298A probably damaging Het
Olfr866 G C 9: 20,027,733 N68K possibly damaging Het
Phf10 T A 17: 14,945,115 N493I probably benign Het
Prr12 T C 7: 45,045,914 E1376G unknown Het
Rin3 G A 12: 102,369,680 V537M probably damaging Het
Samd4 C T 14: 47,096,109 T272I probably damaging Het
Sept5 C T 16: 18,623,392 G257D probably damaging Het
Serpina6 T C 12: 103,654,067 K141R probably benign Het
Siglecf T A 7: 43,352,276 I170N possibly damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Stk40 G A 4: 126,129,751 probably null Het
Syne1 A G 10: 5,031,768 S8700P probably benign Het
Tbc1d4 C T 14: 101,608,336 G42E probably damaging Het
Tfap2c C T 2: 172,557,182 Q425* probably null Het
Tmem255b T C 8: 13,455,998 S202P probably damaging Het
Traf6 T C 2: 101,684,546 S16P probably benign Het
Ttc12 A G 9: 49,472,405 I66T probably damaging Het
Ttc21a G A 9: 119,958,819 D818N possibly damaging Het
Zfp81 A T 17: 33,334,703 I379N possibly damaging Het
Zgrf1 C A 3: 127,586,100 S211* probably null Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13595410 unclassified probably benign
IGL02112:Rasa3 APN 8 13585042 splice site probably benign
IGL02946:Rasa3 APN 8 13598280 missense probably benign 0.33
IGL03085:Rasa3 APN 8 13585690 missense probably benign 0.11
Box_canyon UTSW 8 13584959 nonsense probably null
Mount_ouray UTSW 8 13631811 missense possibly damaging 0.90
Poncha_pass UTSW 8 13595373 missense possibly damaging 0.46
Ute UTSW 8 13582381 splice site probably benign
PIT4531001:Rasa3 UTSW 8 13605887 missense probably benign 0.11
R0193:Rasa3 UTSW 8 13570233 splice site probably null
R0710:Rasa3 UTSW 8 13583830 missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13580118 splice site probably benign
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13582372 missense probably benign 0.44
R1828:Rasa3 UTSW 8 13585035 missense probably benign 0.02
R1895:Rasa3 UTSW 8 13631768 splice site probably benign
R2090:Rasa3 UTSW 8 13582381 splice site probably benign
R2374:Rasa3 UTSW 8 13577411 missense probably damaging 1.00
R2655:Rasa3 UTSW 8 13595373 missense possibly damaging 0.46
R3703:Rasa3 UTSW 8 13588972 missense probably benign
R3899:Rasa3 UTSW 8 13578635 missense probably benign 0.21
R4230:Rasa3 UTSW 8 13570264 missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13614532 critical splice donor site probably null
R4281:Rasa3 UTSW 8 13588946 missense probably benign 0.01
R4558:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13588865 missense probably null 0.00
R4702:Rasa3 UTSW 8 13570394 missense probably benign 0.09
R4772:Rasa3 UTSW 8 13598289 missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13577501 missense probably benign 0.07
R4807:Rasa3 UTSW 8 13614633 missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13584959 nonsense probably null
R5043:Rasa3 UTSW 8 13570368 missense possibly damaging 0.59
R5352:Rasa3 UTSW 8 13631778 missense possibly damaging 0.88
R5435:Rasa3 UTSW 8 13631811 missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13598251 missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13580037 missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13585029 missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13631826 missense probably benign 0.29
R7100:Rasa3 UTSW 8 13586897 missense probably benign 0.02
R7322:Rasa3 UTSW 8 13595857 missense possibly damaging 0.46
R7394:Rasa3 UTSW 8 13595353 missense probably benign 0.03
R7478:Rasa3 UTSW 8 13614605 missense possibly damaging 0.70
R7486:Rasa3 UTSW 8 13590201 critical splice donor site probably null
R7554:Rasa3 UTSW 8 13595390 missense probably damaging 0.99
R7575:Rasa3 UTSW 8 13595887 missense possibly damaging 0.73
R7641:Rasa3 UTSW 8 13584961 missense probably benign 0.11
R7667:Rasa3 UTSW 8 13588015 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCGCTAATCTCCTAGTCCTTAG -3'
(R):5'- CTTTACATGTGGACCCATGCG -3'

Sequencing Primer
(F):5'- TAGTCCTTAGGGCAGCAGG -3'
(R):5'- GACCCATGCGCTAGAGATTGTTAC -3'
Posted On2015-07-21