Incidental Mutation 'R4542:Rfx1'
ID333584
Institutional Source Beutler Lab
Gene Symbol Rfx1
Ensembl Gene ENSMUSG00000031706
Gene Nameregulatory factor X, 1 (influences HLA class II expression)
Synonyms
MMRRC Submission 041593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4542 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84066834-84096992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84090237 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 466 (G466S)
Ref Sequence ENSEMBL: ENSMUSP00000005600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005600] [ENSMUST00000211046]
Predicted Effect probably damaging
Transcript: ENSMUST00000005600
AA Change: G466S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005600
Gene: ENSMUSG00000031706
AA Change: G466S

DomainStartEndE-ValueType
low complexity region 11 47 N/A INTRINSIC
low complexity region 53 67 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
Pfam:RFX1_trans_act 106 176 9.6e-9 PFAM
Pfam:RFX1_trans_act 211 366 1.8e-59 PFAM
Pfam:RFX_DNA_binding 420 498 2.5e-35 PFAM
Blast:HisKA 705 768 3e-28 BLAST
low complexity region 908 920 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210660
Predicted Effect probably damaging
Transcript: ENSMUST00000211046
AA Change: G466S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulatory factor X (RFX) family of transcription factors, which are characterized by a winged-helix DNA-binding domain. The encoded transcription factor contains an N-terminal activation domain and a C-terminal repression domain, and may activate or repress target gene expression depending on cellular context. This transcription factor has been shown to regulate a wide variety of genes involved in immunity and cancer, including the MHC class II genes and genes that may be involved in cancer progression. This gene exhibits altered expression in glioblastoma and the autoimmune disease systemic lupus erythematosis (SLE). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,256,592 L833Q probably damaging Het
Adcy6 C G 15: 98,598,988 V469L possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 T A 8: 104,210,959 F57I probably damaging Het
Brinp1 T C 4: 68,762,092 I734V probably benign Het
Cab39l C A 14: 59,496,902 D23E probably benign Het
Cfap54 T C 10: 93,025,129 T839A probably benign Het
Clgn A G 8: 83,420,209 E297G probably damaging Het
Crip1 A G 12: 113,153,489 Y108C probably damaging Het
Cxcr2 A G 1: 74,158,529 S61G probably benign Het
Dph5 T C 3: 115,928,625 S251P probably damaging Het
E2f7 T A 10: 110,767,123 V333E probably damaging Het
Eif4g3 A G 4: 138,203,417 D918G probably damaging Het
Epn1 A G 7: 5,093,981 E254G possibly damaging Het
Fat1 T C 8: 45,041,894 C4065R probably damaging Het
Gja1 T C 10: 56,388,052 F169S probably damaging Het
Kmt2b A G 7: 30,580,259 I1384T probably damaging Het
Ltbp2 A T 12: 84,831,819 L302* probably null Het
Nalcn T C 14: 123,321,477 silent Het
Nlrp1b A C 11: 71,228,325 L48W probably damaging Het
Nlrp4c G A 7: 6,100,827 W920* probably null Het
Nr2f1 C T 13: 78,189,821 G235D probably damaging Het
Nt5dc2 T A 14: 31,138,138 D374E probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Olfr78 T C 7: 102,742,643 D120G probably damaging Het
Olfr993 T C 2: 85,413,943 D312G probably benign Het
Pikfyve T C 1: 65,244,430 I742T probably damaging Het
Rftn1 A G 17: 50,055,231 probably null Het
Scn11a A T 9: 119,755,134 S1472T probably damaging Het
Sh2d4a A G 8: 68,346,742 Q421R probably benign Het
Slc25a10 G A 11: 120,497,981 probably null Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Spen T C 4: 141,476,786 Y1510C unknown Het
Ssu72 A G 4: 155,733,477 Q163R probably benign Het
Stau1 A G 2: 166,953,261 Y223H probably damaging Het
Syne3 A T 12: 104,969,244 S92T probably benign Het
Ulbp1 T C 10: 7,456,570 D45G probably damaging Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Vmn1r67 A G 7: 10,447,430 Y207C probably damaging Het
Vmn2r59 T C 7: 42,046,073 D305G possibly damaging Het
Zbtb18 A G 1: 177,448,666 K522E probably damaging Het
Other mutations in Rfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Rfx1 APN 8 84092972 critical splice acceptor site probably null
IGL01779:Rfx1 APN 8 84092662 splice site probably benign
IGL02505:Rfx1 APN 8 84095809 missense possibly damaging 0.79
IGL02741:Rfx1 APN 8 84095842 missense possibly damaging 0.94
R1565:Rfx1 UTSW 8 84073946 missense probably benign
R1793:Rfx1 UTSW 8 84066421 unclassified probably benign
R1808:Rfx1 UTSW 8 84095048 missense probably damaging 1.00
R1971:Rfx1 UTSW 8 84095497 missense probably damaging 1.00
R4690:Rfx1 UTSW 8 84082745 missense possibly damaging 0.50
R4995:Rfx1 UTSW 8 84080114 splice site probably null
R5163:Rfx1 UTSW 8 84093211 missense probably damaging 0.98
R5212:Rfx1 UTSW 8 84066592 unclassified probably benign
R5227:Rfx1 UTSW 8 84074058 missense probably damaging 0.99
R5401:Rfx1 UTSW 8 84066376 unclassified probably null
R5431:Rfx1 UTSW 8 84082720 nonsense probably null
R5584:Rfx1 UTSW 8 84088077 splice site probably null
R5693:Rfx1 UTSW 8 84073904 missense unknown
R6210:Rfx1 UTSW 8 84093018 missense probably damaging 1.00
R6715:Rfx1 UTSW 8 84095815 missense possibly damaging 0.49
R6920:Rfx1 UTSW 8 84095488 missense probably damaging 1.00
R7131:Rfx1 UTSW 8 84095079 missense probably damaging 0.96
R7155:Rfx1 UTSW 8 84094826 missense probably damaging 0.99
R7336:Rfx1 UTSW 8 84073756 start gained probably benign
R7467:Rfx1 UTSW 8 84073913 missense possibly damaging 0.86
Z1177:Rfx1 UTSW 8 84090277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTTGCAGAAAACTCAGC -3'
(R):5'- AAGATGGCCCAAGGGATGTC -3'

Sequencing Primer
(F):5'- TCAGCCACGCAGACTGTCAG -3'
(R):5'- TCCCCAGGGTAGGCACAAG -3'
Posted On2015-08-18