Incidental Mutation 'R4526:Scamp4'
ID334449
Institutional Source Beutler Lab
Gene Symbol Scamp4
Ensembl Gene ENSMUSG00000113949
Gene Namesecretory carrier membrane protein 4
SynonymsSc4, 2410022D05Rik
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80602872-80615783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80611057 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 108 (F108S)
Ref Sequence ENSEMBL: ENSMUSP00000137003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038411] [ENSMUST00000079883] [ENSMUST00000178231] [ENSMUST00000180350] [ENSMUST00000218067] [ENSMUST00000220669] [ENSMUST00000221032] [ENSMUST00000221387] [ENSMUST00000221670] [ENSMUST00000221960] [ENSMUST00000223256]
Predicted Effect probably benign
Transcript: ENSMUST00000038411
SMART Domains Protein: ENSMUSP00000040551
Gene: ENSMUSG00000113640

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 170 308 5.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079883
AA Change: F108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078808
Gene: ENSMUSG00000113949
AA Change: F108S

DomainStartEndE-ValueType
Pfam:SCAMP 4 180 4.7e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178231
SMART Domains Protein: ENSMUSP00000136259
Gene: ENSMUSG00000035370

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 170 308 1.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180350
AA Change: F108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137003
Gene: ENSMUSG00000113949
AA Change: F108S

DomainStartEndE-ValueType
Pfam:SCAMP 5 179 1.2e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184456
Predicted Effect probably benign
Transcript: ENSMUST00000218067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219462
Predicted Effect probably benign
Transcript: ENSMUST00000220669
Predicted Effect probably benign
Transcript: ENSMUST00000221032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221236
Predicted Effect probably benign
Transcript: ENSMUST00000221387
Predicted Effect probably benign
Transcript: ENSMUST00000221670
Predicted Effect probably benign
Transcript: ENSMUST00000221960
Predicted Effect probably benign
Transcript: ENSMUST00000223256
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Secretory carrier membrane proteins (SCAMPs) are widely distributed integral membrane proteins implicated in membrane trafficking. Most SCAMPs (e.g., SCAMP1; MIM 606911) have N-terminal cytoplasmic NPF (arg-pro-phe) repeats, 4 central transmembrane regions, and a short C-terminal cytoplasmic tail. These SCAMPs likely have a role in endocytosis that is mediated by their NPF repeats. Other SCAMPs, such as SCAMP4, lack the NPF repeats and are therefore unlikely to function in endocytosis (summary by Fernandez-Chacon and Sudhof, 2000 [PubMed 11050114]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Scamp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Scamp4 APN 10 80609422 missense probably damaging 0.99
ANU23:Scamp4 UTSW 10 80609422 missense probably damaging 0.99
R0846:Scamp4 UTSW 10 80614703 missense probably benign 0.10
R4910:Scamp4 UTSW 10 80609671 missense probably damaging 0.97
R5941:Scamp4 UTSW 10 80612421 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCATGATACTGGGGCTC -3'
(R):5'- ATCTAGACAAGCCTGGGAGC -3'

Sequencing Primer
(F):5'- GCTCCAGTTCTGCCTGTGG -3'
(R):5'- ACAAGCCTGGGAGCAGCTG -3'
Posted On2015-08-18