Incidental Mutation 'R4526:Olfr1156'
ID334432
Institutional Source Beutler Lab
Gene Symbol Olfr1156
Ensembl Gene ENSMUSG00000075144
Gene Nameolfactory receptor 1156
SynonymsMOR174-3, GA_x6K02T2Q125-49433499-49432537
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87947053-87953100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87949409 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 275 (T275A)
Ref Sequence ENSEMBL: ENSMUSP00000149665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099842] [ENSMUST00000215903] [ENSMUST00000216191] [ENSMUST00000216726]
Predicted Effect probably benign
Transcript: ENSMUST00000099842
AA Change: T275A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097430
Gene: ENSMUSG00000075144
AA Change: T275A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.2e-47 PFAM
Pfam:7tm_1 41 290 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215903
Predicted Effect probably benign
Transcript: ENSMUST00000216191
AA Change: T275A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216726
AA Change: T275A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Olfr1156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Olfr1156 APN 2 87949863 missense probably damaging 0.99
IGL02831:Olfr1156 APN 2 87949676 splice site probably null
IGL03214:Olfr1156 APN 2 87950071 missense probably benign 0.16
R0285:Olfr1156 UTSW 2 87950131 missense probably damaging 0.98
R0926:Olfr1156 UTSW 2 87949922 missense probably damaging 1.00
R0987:Olfr1156 UTSW 2 87949547 missense probably benign 0.12
R1422:Olfr1156 UTSW 2 87950095 missense probably benign 0.00
R1958:Olfr1156 UTSW 2 87949465 missense probably damaging 1.00
R2239:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R2380:Olfr1156 UTSW 2 87949397 missense probably damaging 1.00
R3872:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3873:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R3874:Olfr1156 UTSW 2 87949530 missense probably damaging 1.00
R5116:Olfr1156 UTSW 2 87949529 missense probably benign 0.03
R5985:Olfr1156 UTSW 2 87949321 missense probably benign 0.02
R5999:Olfr1156 UTSW 2 87949801 splice site probably null
R6127:Olfr1156 UTSW 2 87949361 missense probably damaging 1.00
R6259:Olfr1156 UTSW 2 87949435 missense probably benign 0.20
R6544:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6556:Olfr1156 UTSW 2 87949976 missense probably benign 0.00
R6715:Olfr1156 UTSW 2 87949991 missense probably benign 0.35
R6951:Olfr1156 UTSW 2 87949979 missense possibly damaging 0.79
R7062:Olfr1156 UTSW 2 87950224 missense probably benign 0.01
R7142:Olfr1156 UTSW 2 87949712 missense probably benign 0.09
R7749:Olfr1156 UTSW 2 87949478 missense probably damaging 1.00
R7887:Olfr1156 UTSW 2 87949880 missense probably damaging 1.00
R8222:Olfr1156 UTSW 2 87949444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTCTACATTAGGCTCACC -3'
(R):5'- CTTGGCCCTTGAGATCACATC -3'

Sequencing Primer
(F):5'- GGTCTTCACTATGAAACCCTA -3'
(R):5'- GCTTGCTCTGATGTTAGTACAAATG -3'
Posted On2015-08-18