Incidental Mutation 'R4526:Ly75'
ID334430
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Namelymphocyte antigen 75
SynonymsDEC-205, CD205
MMRRC Submission 041591-MU
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location60292103-60383303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60330773 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 900 (T900M)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
Predicted Effect probably benign
Transcript: ENSMUST00000028362
AA Change: T900M

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: T900M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112533
AA Change: T900M

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: T900M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Vmn2r60 A G 7: 42,195,243 T677A probably damaging Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 unclassified probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCCATATTGGAAAGAGCTTCTCTTG -3'
(R):5'- ACCAGATTTCTCTGCATGTTTG -3'

Sequencing Primer
(F):5'- GAGCTTCTCTTGGCAATTTGAGCTAC -3'
(R):5'- CTCTGCATGTTTGGGATCAAAG -3'
Posted On2015-08-18