Incidental Mutation 'R4621:Snrpn'
ID346144
Institutional Source Beutler Lab
Gene Symbol Snrpn
Ensembl Gene ENSMUSG00000102252
Gene Namesmall nuclear ribonucleoprotein N
Synonyms2410045I01Rik, Peg4, Pwcr1
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location59982495-60140219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59987526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 14 (D14G)
Ref Sequence ENSEMBL: ENSMUSP00000096003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059305] [ENSMUST00000098402] [ENSMUST00000179360] [ENSMUST00000189432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059305
AA Change: D14G

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055941
Gene: ENSMUSG00000102252
AA Change: D14G

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098402
AA Change: D14G

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096003
Gene: ENSMUSG00000102252
AA Change: D14G

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179360
SMART Domains Protein: ENSMUSP00000136053
Gene: ENSMUSG00000000948

DomainStartEndE-ValueType
Pfam:SNURF 1 70 4.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189432
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: The protein encoded by this gene is one polypeptide of a small nuclear ribonucleoprotein complex, and it plays a role in pre-mRNA processing. Although individual snRNPs are believed to recognize specific nucleic acid sequences through RNA-RNA base pairing, the specific role of this family member is unknown. This protein arises from a bicistronic transcript that also encodes a protein identified as the Snrpn upstream reading frame (Snurf). Multiple transcription initiation sites have been identified and extensive alternative splicing occurs in the 5' untranslated region. Additional splice variants have been described but sequences for the complete transcripts have not been determined. The 5' UTR of this gene has been identified as an imprinting center. Alternative splicing or deletion caused by a translocation event in this paternally-expressed region in human and mouse is responsible for Angelman syndrome or Prader-Willi syndrome due to parental imprint switch failure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted intragenic deletions are phenotypically normal. Deletions that also encompass neighboring genes on the paternal chromosome exhibit growth retardation, hypotonia, and high mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Snrpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Snrpn APN 7 59987446 missense possibly damaging 0.80
IGL03349:Snrpn APN 7 59985865 missense probably damaging 0.99
R0032:Snrpn UTSW 7 59985082 missense probably damaging 0.99
R1789:Snrpn UTSW 7 59983459 utr 3 prime probably benign
R2057:Snrpn UTSW 7 59987456 missense possibly damaging 0.95
R7600:Snrpn UTSW 7 59988603 start codon destroyed probably null 0.61
R7664:Snrpn UTSW 7 59987491 missense probably benign 0.15
R8183:Snrpn UTSW 7 59985082 missense probably damaging 0.99
R8250:Snrpn UTSW 7 59986885 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACTCTGAGGTATATTGCTTTAGC -3'
(R):5'- ACTTTAAGGTTCTGAGAAGTGTCG -3'

Sequencing Primer
(F):5'- ATATTGCTTTAGCTCAAAACTTCCC -3'
(R):5'- AAGCTAATGTTAGAAAACTGG -3'
Posted On2015-09-25